Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Journal of Immunological Methods 276 (2003) 185 – 196 www.elsevier.com/locate/jim Recombinant Technology Isolation and expression of recombinant antibody fragments to the biological warfare pathogen Brucella melitensis Andrew Hayhurst a,b,1, Scott Happe a,1,2, Robert Mabry a,c, Zephyr Koch a, Brent L. Iverson a,c,*, George Georgiou a,b,d,* a Institute for Cellular and Molecular Biology, University of Texas at Austin, Austin, TX 78712-1095, USA b Chemical Engineering Department, University of Texas at Austin, Austin, TX 78712-1062, USA c Department of Chemistry and Biochemistry, University of Texas at Austin, Austin, TX 78712, USA d Biomedical Engineering Program, University of Texas at Austin, Austin, USA Received 28 August 2002; received in revised form 15 January 2003; accepted 15 January 2003 Abstract Brucella melitensis is a highly infectious animal pathogen able to cause a recurring debilitating disease in humans and is therefore high on the list of biological warfare agents. Immunoglobulin genes from mice immunized with gammairradiated B. melitensis strain 16M were used to construct a library that was screened by phage display against similarly prepared bacteria. The selected phage particles afforded a strong enzyme-linked immunosorbent assay (ELISA) signal against gamma-irradiated B. melitensis cells. However, extensive efforts to express the respective single chain antibody variable region fragment (scFv) in soluble form failed due to: (i) poor solubility and (ii) in vivo degradation of the c-myc tag used for the detection of the recombinant antibodies. Both problems could be addressed by: (i) fusing a human kappa light chain constant domain (Ck) chain to the scFv to generate single chain antibody fragment (scAb) antibody fragments and (ii) by co-expression of the periplasmic chaperone Skp. While soluble, functional antibodies could be produced in this manner, phage-displaying scFvs or scAbs were still found to be superior ELISA reagents for immunoassays, due to the large signal amplification afforded by anti-phage antibodies. The isolated phage antibodies were shown to be highly Abbreviations: BCA, bicinchoninic acid; BSA, bovine serum albumin; Ck, human kappa light chain constant domain; Cm, chloramphenicol resistance gene; ELISA, enzyme-linked immunosorbent assay; FPLC, fine performance liquid chromatography; HRP, horseradish peroxidase; IMAC, immobilized metal affinity chromatography; g3p, M13 gene III protein; g8p, M13 gene VIII protein; IPTG, isopropyl h-D-thiogalactopyranoside; LPS, lipopolysaccharide; phAb, phage displayed antibody fragment; MALDI/TOF, matrix-assisted laser desorption ionization/time of flight; M-MLV, Moloney-murine leukemia virus; Mab, monoclonal antibody; PBS, phosphate-buffered saline; RT-PCR, reverse transcriptase-polymerase chain reaction; scAb, single chain antibody fragment; scFv, single chain antibody variable region fragment; SDS-PAGE, sodium dodecyl sulfate polyacrylamide electrophoresis; TB, terrific broth; Tween-20, polyoxyethylenesorbitan monolaurate. * Corresponding authors. B.L. Iverson, Department of Chemistry and Biochemistry, University of Texas at Austin, Austin, TX 78712-1062, USA. Tel.: +1-512-471-5053; fax: +1-512-471-8696. G. Georgiou, Chemical Engineering Department, University of Texas at Austin, Austin, TX 78712-1095, USA. Tel.: +1-512-471-6975; fax: +1-512-471-7963. E-mail addresses: biverson@utxvms.cc.utexas.edu (B.L. Iverson), gg@che.utexas.edu (G. Georgiou). 1 These authors contributed equally to this work. 2 Present address: Bio Crest/Stratagene, Cedar Creek, TX 78612, USA. 0022-1759/03/$ - see front matter D 2003 Elsevier Science B.V. All rights reserved. doi:10.1016/S0022-1759(03)00100-5 186 A. Hayhurst et al. / Journal of Immunological Methods 276 (2003) 185–196 specific to B. melitensis and did not recognize Yersinia pseudotuberculosis in contrast to the existing diagnostic monoclonal YST 9.2.1. D 2003 Elsevier Science B.V. All rights reserved. Keywords: Biological agent detection; Brucella melitensis; Phage display; scFv; 9E10; c-myc tag 1. Introduction The Brucellae are Gram-negative facultative intracellular pathogens that are responsible for zoonoses worldwide (Corbel, 1997; Boschiroli et al., 2001; Moreno and Moriyon, 2002). Infection causes abortion in wild and domestic animals resulting in enormous financial losses especially in developing parts of the world. Contact with infected animals can result in human infection, which while rarely fatal, can cause long-term recurring illness marked by debilitating malaise and fever. Brucellae are easily dispersed in aerosols, have a low dose to infectivity ratio, and can survive extended periods of time separated from their host. As a result of these features, the Brucellae, particularly Brucella melitensis, Brucella abortus, and Brucella suis, were among the first organisms to be considered as offensive biological warfare weapons (Franz et al., 1997). Indeed, these three of six very closely related species remain on the Centers for Disease Control and Prevention select agent list. Rapid approaches for detecting Brucellae bypass the requirement for lengthy and fastidious culture conditions (Doern, 2000; Sumerkan et al., 2001) and include real-time PCR (Sreevatsan et al., 2000; Redkar et al., 2001), fluorescence whole cell nucleic acid hybridization (Fernandez-Lago et al., 2000), or immunoassays utilizing antibodies able to specifically recognize Brucellae cells. Current immunoassay methods employ antibodies to lipopolysaccharide (LPS), the immunodominant surface antigen (Berger et al., 1969). However, the immunologically distinguishing feature in the LPS of the Brucellae, the O:9 epitope, is also shared by certain Yersiniae (Caroff et al., 1984). As a result, many existing anti-Brucellae sera exhibit cross-reactivity with the Yersiniae (Bundle et al., 1984). It is important to be able to distinguish between these two organisms as double infections can be common (Kittelberger et al., 1995) and since certain Yersiniae are also considered potential biological warfare agents. Recombinant antibody fragments are gaining ground as supplements to monoclonal and polyclonal animal sera in the biological agent diagnostic and detection arena (Emanuel et al., 2000). Genetic manipulation can be employed to tailor affinity and specificity (Chen et al., 1999; Short et al., 2001), stability (Reiter et al., 1994), avidity (Iliades et al., 1997), or to generate chimeras to reporter molecules (Kerschbaumer et al., 1997; Pearce et al., 1997; Casey et al., 2000). Antibody fragments can be readily expressed in Escherichia coli allowing low cost production and purification, an important advantage for many applications including proteomics (Hayhurst and Georgiou, 2001). Phage display is routinely used for the isolation of antibody fragments to a wide variety of antigens including haptens, carbohydrates, peptides, proteins, and surface antigens of intact mammalian cells (Griffiths et al., 1993; Hoogenboom et al., 1998, 1999). Panning of phage display libraries on intact pathogens has also been employed to generate diagnostic and therapeutic antibodies to a wide range of disease causing agents including bacteria. Single chain antibody variable region fragment (scFv) specific for Gram-negative, complement-resistant Moraxella catarrhalis were isolated by competitive selection of a semi-synthetic library with complement-sensitive strains (Boel et al., 1998). Similarly, scFv specific to a surface component of Gram-positive, pathogenic Streptococcus suis were generated by subtractive panning (de Greeff et al., 2000). Finally, scFv directed toward surface associated antigens of Chlamydia trachomatis, including some host cell components, were derived from a naı̈ve scFv library (Lindquist et al., 2002). Here, we used phage display to isolate scFv to gamma-irradiated B. melitensis strain 16M. After panning a biased library on immobilized antigen, A. Hayhurst et al. / Journal of Immunological Methods 276 (2003) 185–196 two phage clones were shown to be specific for the antigen and not cross-reactive with Yersiniae. Efforts to express scFv antibodies revealed several complications with common epitope tags used for detection of scFv. These problems were successfully addressed by converting the scFv into the single chain antibody fragment (scAb) format (McGregor et al., 1994; Hayhurst, 2000) and co-expression of the chaperone Skp (Bothmann and Pluckthun, 1998; Hayhurst and Harris, 1999) to alleviate protein aggregation in the bacterial periplasm. This strategy will be useful for the preparative production of other recombinant antibodies including those specific for biological warfare agents especially since scAb have recently been shown to have improved pharmacokinetic properties over scFv (Maynard et al., 2002). 2. Materials and methods 2.1. Antigens Inactivated B. melitensis strain 16M was provided by Edgewood Chemical and Biological Center (ECBC, Aberdeen Proving Ground, MD). Prior to inactivation, cells were grown in soy trypticase broth, washed, and treated by one of three methods: cobalt gamma-irradiation (3.0 106 rad total dose). Concentration of cells prior to inactivation was 4.5 109 cfu/ml; inactivation was confirmed by culture of 1.0 ml of suspension on solid media. The following Yersinia species were provided by ECBC to test for scFv cross-reactivity: Yersinia enterocolitica (ATCC 23715), Yersinia pseudotuberculosis (ATCC 6905, 29833, and NADC 5561, 5560), Yersinia rhodei (ATCC 43380), Yersinia ruckeri (ATCC 29473). 2.2. Antibodies Mouse monoclonal antibody YST 9.2.1 specific for LPS was provided by ECBC. Anti-mouse-HRP was from BioRad (Hercules, CA) and anti-M13 HRP was from Amersham Pharmacia (Piscataway, NJ). AntiFLAG M1, anti-His6 clone-1, anti-myc clone 9E10 and anti-His6 clone-1 HRP conjugate were all from Sigma (St. Louis, MO). 187 2.3. Immunizations Five-week-old female BALB/c mice were purchased from Jackson Laboratories (Bar Harbor, ME). Mice were housed at the Texas Center for Infectious Diseases (TCID, San Antonio, TX) on a 12h light/dark cycle and given food and water ad libitum. All animal handling procedures were performed according to TCID guidelines. For the first immunization, bacterial suspensions in saline were mixed with an equal volume of Freund’s complete adjuvant (Sigma) to form a stable emulsion. Mice were anesthetized via inhalation of Metofane and injected intramuscularly at 0.1 ml per site with each animal receiving a total of 1 109 bacteria per immunization. The mice were boosted with bacterial cells emulsified in Freund’s incomplete adjuvant 1, 4 and 8 weeks later. Control mice were inoculated with saline in place of bacterial suspension following the same schedule. Six days after the final boost, mice were anesthetized, bled via cardiac puncture, and sacrificed for tissue harvest. Spleens were removed and placed into RNAlaterk storage buffer on ice (Ambion, Austin, TX) prior to processing and RNA extraction. 2.4. scFv library construction Spleens were teased apart in ice-cold PBS, transferred to guanidinium denaturation solution, and disrupted using a Dounce homogenizer. Total RNA was extracted using the ToTALLY RNAk kit (Ambion) with twice the recommended volume of denaturation buffer to reduce the viscosity of the extract. Total RNA (3.7 Ag/50 Al reaction) was subjected to RT-PCR using the RetroScript kit (Ambion) with oligo-dT18 and M-MLV reverse transcriptase either at 42 jC (VH samples) or 54 jC (VL samples). PCR and scFv assembly was performed using standard conditions (Krebber et al., 1997) to generate a library of 5 105 clones which was subsequently rescued with helper phage M13KO7. 2.5. Phage display and panning Gamma-irradiated B. melitensis 16M (6 107 cfu/ ml), in a total volume of 4 ml PBS, was coated overnight in MaxiSorp Immunotubes (Nunc, Roches- 188 A. Hayhurst et al. / Journal of Immunological Methods 276 (2003) 185–196 ter, NY) at 4 jC. The tube was blocked with 1% BSA/ PBS for 2 h at 37 jC. Phage particles (109) were added in BSA/PBS, incubated for 1 h at room temperature on an end-over-end turntable, followed by overnight at room temperature without agitation. The immunotube was washed 15 times with PBS/0.1% Tween-20, followed by 15 times with PBS alone. Bound phage were eluted for 10 min in 1 ml 100 mM triethylamine, neutralized with 0.5ml 1M Tris – HCl pH 7.5, and used to infect exponentially growing TG1 cells. Infected cells were plated overnight on 2 TY/30 Ag/ml chloramphenicol + 1% glucose. The next day, cells were scraped from the plates, grown to exponential phase, and rescued with M13KO7 helper phage. Infected cells were grown overnight in 2 TY/ 30 Ag/ml chloramphenicol + 1% glucose and 30 Ag/ ml kanamycin and 1 mM IPTG at 30 jC. Phage were purified by polyethylene glycol/NaCl precipitation and resuspended in a total volume of 2 ml PBS. One milliliter was used for the next round of panning, for a total of four rounds. 2.6. Enzyme-linked immunosorbent assay (ELISA) Wells of MaxiSorp microtitre plates (Nunc) were coated with 100 Al the same dilution of gammairradiated B. melitensis suspension as used for panning. 100 Al of OD600 = 1.0 suspensions of the other bacterial antigens were used to coat. Standard ELISA blocking and washing procedures were used throughout for both phage and antibody fragments (Chen et al., 2001) with antibodies used at the manufacturer’s recommended dilutions. Buffer containing 1 mM calcium chloride was used throughout for FLAG-M1 antibody experiments to satisfy the requirement for calcium ions. Data points are the average of duplicate dilutions with each experiment being done at least twice. Antibody fragment and phAb ELISAs were also carried out with BSAcoated wells as control for each dilution and these blanks subtracted to counter background-binding effects. 2.7. Antibody fragment expression vector construction Primers AHX77 (5V-TATATAGGCCTCGGGGGCCGAATTCGCGGCCGCAGTCGACCATCATC AT C A C C AT C A C G - 3 V) a n d A H X 7 8 ( 5 V- GCGCAAGCTTGCGATATCACTATGCGGCGCGCCCATTCAGATCCTCTTC-3V) were used for PCR amplification of the His6 c-myc tag region from pHEN2 (Griffin library protocol, Medical Research Council, UK) which in turn was used to replace the His6 tag in pAK400 (Krebber et al., 1997) via SfiI/ HindIII to create pMoPac1. Subsequently, the chloramphenicol resistance gene (Cm) of pMoPac1 was replaced with an ampicillin resistance gene. Kunkel template of pMoPac1 was generated by co-transfection of vector and M13KO7 replicative form into CJ236Fem, a derivative of E. coli CJ236 cured of the chloramphenicol resistant FV episome by repeated growth in the absence of chloramphenicol. Kunkel mutagenesis using both AHX71 (5V-CCAGTGATTTTTTTCTCCATTTAAATCTTCCTTAGCTCCTGAAAATC-3V) and AHX72 (5V-GGGCACCAATAACTGCCTATTTAAATTTACGCCCCGCCCTGCC-3V) introduced unique SwaI restriction sites either side of the pMoPac1 Cm gene enabling facile uni-directional resistance gene exchange employing the vectors own Cm promoter. In this manner, the h-lactamase gene was amplified from pUC19 using AHX73 (5V-ATATATATTTAAATGAGTATTCAACATTTCCG-3V) and AHX74 (5V-GCGCGCATTTAAATTTACCAATGCTTAATCAGTG-3V), introduced via SwaI sites and clones selected upon media containing 200 Ag/ml ampicillin designated pMoPac10. A cistron encoding the periplasmic chaperone Skp was placed downstream of the scFv expression cassette. Primers AHX155 (5V-ATATAAGCTTTAAGGAGATATATATATGAAAAAGTGGTTATTAGCTGCA-3V) and AHX156 (5V- GTGGGGATCCGT G A C G C A G TA G C G G TA A A C G G C A G A C A A A A A A A AT G T C G C A C A AT G T G C G C C AT T T T T C A C T T C A C A G G T C T TAT TAT TTAACCTGTTTCAGTACGTC-3V) were used to amplify the skp gene from pHELP1 (Hayhurst and Harris, 1999) and the product inserted into pMoPac10 via HindIII and BamHI to create pMoPac12. A human kappa constant domain (Ck) (McGregor et al., 1994) was inserted downstream of the scFv to enable scAb (scFv-Ck) expression. A pel-specific primer and AHX88 (5V-CGCGCGTCGACTGACTCTCCGCGGTTG-3V) were used to amplify a scAb from pIMS100 (Hayhurst, 2000) and the Ck domain isolated inserted into MoPac10 and MoPac12 via NotI A. Hayhurst et al. / Journal of Immunological Methods 276 (2003) 185–196 and SalI to create pMoPac15 and 16 respectively. The constructs are schematically shown in Fig. 1 with detail of the linker from pMoPac16 from which all constructs can be deconvoluted. The super-short g3p gene in plasmid pAK100 (Krebber et al., 1997) was amplified using AHX104 ( 5 V- TATA G G C G C G C C G C ATA G A C T G G TGGTGGCTCTGGTTCC-3V) and AHX105 (5VGCGCAAGCTTGCGATATCAAGACTCCTTATTACGC-3V) and mobilized into pMoPac10, 12, 15, and 16 via AscI and HindIII to form phage display equivalents pMoPac23, 24, 25 and 26, respectively. C10 and H1 scFv were mobilized between vectors using SfiI. All constructs employing PCR amplified products were sequenced through that region after being first isolated. 189 2.8. Antibody fragment expression, analysis and purification Cell growth, fractionation and analyses were performed essentially as described previously (Chen et al., 2001) except that the cells were grown in glucosefree TB and induced with 1 mM IPTG. Antibody fragments were isolated from mid-scale 400 ml cultures with 0.5 ml of nickel charged 6FF resin (Amersham Pharmacia) and eluted in 1 ml of which 0.5 ml was then applied to a Superdex 200 HR10/30 column (Amersham Pharmacia) and gel filtration performed using an Äkta FPLC system (Amersham Pharmacia). Fractions (0.5 ml) were collected and those representing monomeric scAb pooled and quantified using micro-BCA (Pierce, Rockford, IL). Proteins used to calibrate the column were from the molecular weight gel filtration standard kits from Amersham Pharmacia. 2.9. MALDI/TOF mass spectrometry of purified scAb Fig. 1. (a) Schematic diagram of the expression cassettes employed to rationalize and solve the poor expression characteristics of the antibody fragments C10 and H1. The parental vector is pAK400 (Krebber et al., 1997) where the antibody fragments are targeted to the E. coli periplasm using a pelB leader sequence. Abbreviations: F, FLAG tag; H, His6 tag; M, myc tag; scFv single chain antibody variable region fragment; Ck, human kappa light chain constant domain; Skp, seventeen kilo Dalton protein, the periplasmic chaperone. (b) Detail of the pMoPac16 vector region C-terminal to scFv inserts with pertinent restriction sites highlighted. S/D represents a Shine Dalgarno sequence. The inclusion of NotI allows NcoI/NotI scFv mobilization from older pHEN style libraries as well as newer unidirectional SfiI based assemblies (Krebber et al., 1997). The arrow after the His6 tag indicates the likely C terminus of DscAb which lacks the c-myc tag. Mass spectrometry was performed on a Voyager MALDI/TOF mass spectrometer (PerSeptive Biosystems, Framingham, MA) in the Protein Microanalysis Facility of the University of Texas at Austin. Protein samples were diluted into freshly prepared saturated sinapinic acid dissolved in 50% acetonitrile, 0.3% TFA. Sample aliquots of 0.5 or 1.0 ml were spotted onto stainless steel sample plates and spectra were collected by averaging 10 –20 laser shots. Samples were irradiated with a 377-nm nitrogen laser (Laser Science, Franklin, MA) attenuated and focused on the sample target using the built-in software. Ions were accelerated with a deflection voltage of 30 kV. Ions were differentiated according to their m/z using a time-of-flight mass analyzer. 3. Results and discussion 3.1. Isolation of Brucella-specific antibody fragments Mice were immunized with gamma-irradiated B. melitensis 16M to provide a source of biased immunoglobulin genes for library construction. ELISA performed with sera collected after 8 weeks indicated that the immunized mice mounted a strong immune 190 A. Hayhurst et al. / Journal of Immunological Methods 276 (2003) 185–196 response to gamma-irradiated B. melitensis yet no reactivity to E. coli, with serum from control salineinjected mice showing no reactivity against either bacterium (data not shown). A scFv library was constructed from immunoglobulin genes amplified by RT-PCR from the spleens of two mice. Subsequently, the scFv genes were fused to M13 g3p and the resulting phage display library was panned on immobilized gamma-irradiated B. melitensis. Following binding of the phage, the cells were incubated overnight to reduce potential for selection of LPS-binders exhibiting high off-rates (Deng et al., 1994). Monoclonal phage ELISA of 94 clones from the round 4 population identified eight clones giving ELISA signals approximately five times above background. These were sequenced to reveal two unique clones, designated C10 and H1 (sequences submitted to Genbank). 3.2. Expression of Brucella-specific antibody fragments The C10 and H1 scFv genes were subcloned from the phage display vector pAK100 to the periplasmic expression vector pAK400 (Krebber et al., 1997). pAK400 was designed for antibody fragment expression in E. coli and consists of a pUC replicon with a tightly regulated lac promoter (Krebber et al., 1996) that, upon induction, results in relatively high scFv expression levels thanks to the presence of a strong ribosomal-binding site. However, no signal was obtained in ELISA assays using gamma-irradiated B. melitensis 16M as capture antigen and osmotic shockates from E. coli BL21 cells containing pAK400 C10 or H1 scFv as the analytes. The capture assay used anti-FLAG-M1 or anti-His6 as primary antibodies and anti-mouse-HRP as secondary antibody-conjugate. Fig. 2. Gamma-irradiated B. melitensis antibody fragment capture ELISA of antibody fragments in osmotic shockates of normalized smallscale expressions for C10 or H1 expressed as scFv from pMoPac10, scFv with Skp from pMoPac12, scAb from pMoPac15 and scAb with Skp from pMoPac16. Shockates were twofold serially diluted in PBS/BSA. Antibody fragment detection was using anti-FLAG M1 serum, anti-myc 9E10 serum or anti-His6 serum followed by anti-mouse HRP conjugate. Development was 2 h for C10 and overnight for H1. A. Hayhurst et al. / Journal of Immunological Methods 276 (2003) 185–196 We reasoned that the absence of ELISA signal could be due to a combination of two factors: (i) the occlusion of the N-terminal FLAG peptide epitope and (ii) the relatively low affinity of anti-His6 sera for the C-terminally fused hexahistidine tag. To address these issues, a c-myc peptide epitope that is recognized by the 9E10 monoclonal antibody was placed at the C terminus of the scFv adjacent to the hexahistidine tag in the style of the commonly used display vector pHEN2 (Fig. 1). Still, no ELISA signal could be detected from osmotic shock fractions of cells expressing C10 or H1 scFv antibodies fused to the C-terminal c-myc tag. Co-expression of the periplasmic chaperone Skp which is known to improve the solubility of scFv antibodies (Bothmann and Pluckthun, 1998; Hayhurst and Harris, 1999) did not remedy the situation. Only the fusion of a human Ck domain between the scFv and His6-myc tags resulted in detectable ELISA signals for both C10 and H1 clones using secondary anti-His6 sera or antimyc sera but not anti-FLAG M1 sera (Fig. 2). Western blot analysis (Fig. 3) of scFv and scAb fragments from the osmotic shock and spheroplast fractions (the latter also contains aggregated mem- 191 brane-bound proteins which centrifuge together with spheroplasts) revealed that: (a) N-terminal FLAG: The FLAG epitope is detectable in both the scFv and the scAb fragments indicating that the N terminus of the proteins is not subject to degradation but is most likely occluded during the ELISA assay. Co-expression of Skp increases the production of soluble C10 modestly and that of H1 dramatically in both scFv and scAb formats. A doublet is visible for each format with a lower molecular weight species DscFv predominant and DscAb a relatively minor species. (b) C-terminal proximal His6 tag: The His6 tag is not subject to degradation and is present on scFv and scAb. The His6 tag is also present on DscFv and DscAb. (c) C-terminal myc tag: The absence of a band corresponding to soluble scFv indicates that the c-myc epitope is subject to extensive degradation. Conversion of the scFv into the scAb format partially alleviated this problem and co-expression of Skp resulted in a further increase in the Fig. 3. Western blot of osmotic shockates (o) as used in ELISA in Fig. 2 and the remaining spheroplast fractions (s). + indicates Skp coexpression and indicates no Skp supplement. Electrophoresis was on a 12% Laemmli gel and the Western blots were probed sequentially with three different antisera to establish a correlate between ELISA signal and immuno-reactive protein content. Following each probing was a 2 10-min room temperature stripping step (Kaufmann et al., 1987) with overnight reblocking with milk. Exposures represent approx. 5s. Approximate positions of molecular weight markers are shown in kDa and were deduced from the positions of Rainbow markers (Amersham Pharmacia) on the Immobilon-P membrane. Anti-h-lactamase serum was used to confirm the fractionation had succeeded on a separate blot (data not shown). 192 A. Hayhurst et al. / Journal of Immunological Methods 276 (2003) 185–196 production of soluble material. c-myc-specific signal is not evident at locations expected for DscFv or DscAb indicating these species have lost the c-myc epitope. The data in Fig. 3 indicate that the fusion of the Ck domain greatly enhanced the ability to detect the antibody protein as well as the overall expression level especially when combined with Skp co-expression. Indeed, following IMAC and FPLC purification scAb yields were far in excess of scFv yields (Fig. 4) allowing us to generate several hundred micrograms of scAb fragment per liter of pMoPac16 expression cultures. Yields of the corresponding scFv were consistently at least 10-fold lower. 3.3. Mass spectral analysis of IMAC-FPLC purified scAb The monomeric scAb isolated by FPLC was found to migrate as a doublet in Coomassie stained SDSPAGE gels (Fig. 5a). The abundance of the lower molecular weight species increases over time suggesting copurification of a contaminating protease. Both proteins possessed the FLAG tag and His6 tag yet only the higher molecular weight species possessed the c-myc tag as determined by Western blotting (data Fig. 4. FPLC chromatography of IMAC eluates resulting from midscale expression culture of C10 scAb from pMoPac16 (solid line) and C10 scFv from pMoPac12 (dotted line). Molecular weight markers: (1) aldolase—158 kDa; (2) bovine serum albumin—67 kDa; (3) ovalbumin—43 kDa; (4) chymotrypsin—25 kDa. The expression and purification experiments were carried out three times and the same pattern observed in that scAb material by far exceeded scFv material. Fig. 5. (a) SDS-PAGE of IMAC/FPLC purified monomeric C10 scAb protein revealing the two species scAb and DscAb following Coomassie blue staining. (b) MALDI/TOF analysis of the scAb sample to elucidate the site at which the c-myc epitope is lost. not shown). As the entire c-myc sequence is not required for recognition by anti-c-myc monoclonal 9E10 (Hilpert et al., 2001), it was pertinent to determine precisely where the myc tag was being ‘‘lost’’. Therefore, the scAb was analysed by MALDI/TOF spectrometry yielding the masses of the doublet components (Fig. 5b). Since the N-terminal DYKD sequence is present as determined by anti-FLAG M1 reactivity, BioEdit (Hall, 1999) was used to deduce the masses of C-terminal truncations of scAb indicating that DscAb most likely ended immediately after the last histidine residue of the His6 as shown in Fig. 1b. The predicted mass of 39,689.58 Da is within experimental limits of the MALDI/TOF spectrometry determination of 39,667 F 30 Da. We have since found several scFv isolated from a semi-synthetic library (the Griffin library) and expressed from pHEN2 can be subject to the same degradation pattern indicating that the cleavage is not a vector-specific artifact but rather a global problem with early tag design (data not shown). A. Hayhurst et al. / Journal of Immunological Methods 276 (2003) 185–196 193 (data not shown). Unlike purified antigens, the target to which C10 and H1 are specific may be relatively rare and/or occluded and so the one-to-one stoichiometry of secondary antibody HRP conjugate to detection tag on the scAb may be limiting sensitivity. However, when scFv are displayed as g3p fusions, the secondary antibody– HRP conjugate specific for the major coat protein of M13, g8p, is able to amplify the scFv/antigen binding event by virtue of each phage possessing several thousand copies of the g8p protein. The close packing of g8p (Makowski, 1993; Kneissel et al., 1999) and bivalency of the IgG based anti-M13 HRP conjugate will most likely prevent each and every copy of g8p being bound by conjugate. Yet even if 1 in 10 g8p were bound it would result in a 100-fold signal amplification. Having established that phage-borne scFv were the superior detection reagent and having elevated periplasmic expression levels of scFv by conversion to Fig. 6. ELISA detection of gamma-irradiated B. melitensis 16M using (a) IMAC purified scAb protein or (b) phage displayed scFv in pAK100 for the two clones C10 and H1. scAb binding employed anti-His6-HRP for detection while phage binding employed anti g8p-HRP. Color development was allowed to proceed for 15 min. 3.4. Detection of B. melitensis with the recombinant antibodies Purified scAb protein was used in ELISA detection of B. melitensis alongside phage displayed scFv from pAK100. scAb protein capture detection employed anti-His6-HRP conjugate and phAb capture detection employed anti-M13 HRP. We consistently noticed improved signals for phage displayed antibodies compared to their soluble counterparts even though the latter were present in the assay at a significant molar excess (Fig. 6). The use of various anti-His sera and polyclonal anti-Ck sera failed to improve upon the sensitivity of scAb mediated B. melitensis detection Fig. 7. Clone C10 phage ELISA detection of gamma-irradiated B. melitensis using phage display vectors pMoPac23 displaying scFv, pMoPac24 displaying scFv with Skp coexpression, pMoPac25 displaying scAb and pMoPac26 displaying scAb with Skp coexpression. pAK100 displaying scFv was grown fresh and used as a positive control each time. The monoclonal phage stocks were prepared by M13KO7 superinfection of TG-1 bearing the relevant vector and display allowed to proceed for 18 h at 25 jC with 1 mM IPTG in TB plus 2% glucose (plus 30 Ag/ml chloramphenicol for pAK100 and 200 Ag/ml ampicillin for pMoPac vectors). Each vector was rescued, titered and subjected to ELISA on three separate occasions with the same trend in evidence, i.e. (phAbscFv + skp)>(phAbscFv)=(phAbscAb + skp)>(phAbscAb)> pAK100. 194 A. Hayhurst et al. / Journal of Immunological Methods 276 (2003) 185–196 scAb, we sought to combine the two approaches as periplasmic solubility of antibody fragments can be proportional to the efficiency of their display (Coia et al., 1997; Bothmann and Pluckthun, 1998, 2000). However, we consistently observed that phage displaying scFv were almost an order of magnitude more effective in detecting B. melitensis than phage displaying scAb (Fig. 7). Skp co-expression improved the capacity for detection even further. It appears that the larger size of the scAb (42 kDa as opposed to 27 kDa for an scFv) and its propensity to dimerise (Fig. 4 and McGregor et al., 1994) may be decreasing the frequency with which scAb-g3p fusions can assemble onto virions. The specificity of the phAb-C10 antibody towards B. melitensis was evaluated. Reactivity was observed only with gamma-irradiated B. melitensis sample and not with any of the Yersiniae tested (Fig. 8a). This is in contrast to an existing diagnostic monoclonal antibody YST9.2.1 which reacts not only with B. melitensis but Y. pseudotuberculosis (NADC 5561) by virtue of the shared O:9 LPS epitope for which YST 9.2.1 is specific (Fig. 8b). Thus, phAb C10 is clearly able to distinguish species sharing the same major LPS antigen. This is most useful in the diagnostic setting as bacteria sharing common LPS epitopes are often co-isolated and difficult to distinguish. 4. Conclusions Fig. 8. Cross-reactivity ELISA of (a) phAbscFv (C10) and (b) mouse monoclonal YST 0.2.1 for strains of Yersinia. Detection of phAb capture utilized anti-M13-HRP and detection of YST 0.2.1 was revealed with anti-mouse HRP conjugate. Solid circles, Y. pseudotuberculosis (ATCC 6905); open circles, Y. pseudotuberculosis (NADC 5560); solid triangles, Y. pseudotuberculosis (ATCC 29833); open triangles, Y. pseudotuberculosis (NADC 5561); solid squares, Y. enterocolitica (ATCC 23715); Y. rhodei (ATCC 43380); solid diamonds, Y. ruckeri (ATCC 29473); open diamonds, gammairradiated B. melitensis. Recombinant antibody methodology was used to generate antibody fragments specific for the potential bioweapon B. melitensis. Specific washing steps were included in the phage panning procedure to eliminate phage that might be cross-reactive with strains expressing the same dominant LPS epitope. The isolated Brucella-specific scFvs were poorly expressed in E. coli, and they displayed a propensity to lose the commonly used C-terminal c-myc peptide tag due to proteolytic degradation. Gene fusion with a human immunoglobulin kappa constant domain to produce scAb constructs as well as chaperone co-expression using Skp were employed to elevate significantly the production of purified antibody fragment. Despite these improvements, we consistently observed that phAb were two orders of magnitude more sensitive in capture ELISA formats compared to the homologous scAb constructs. Indeed, similar phAb signal amplification has recently been shown to be of use in detecting low levels of Bacillus spores (Zhou et al., 2002) and can doubtless be further improved by polyvalent display (Rondot et al., 2001). Another technical advantage of the phAb format is that production of phage particles is significantly more convenient than recombinant scFv or even scAb expression and isolation from E. coli. A. Hayhurst et al. / Journal of Immunological Methods 276 (2003) 185–196 The isolated antibody fragment referred to as C10 was able to discriminate between B. melitensis and other bacteria that share the same major surface LPS antigen. C10 did not appear to be LPS specific and we are currently elucidating the nature of the antigen. This same strategy of avoiding LPS-specific antibodies while using phAbs to detect relatively rare but unique epitopes should allow rapid definition of bacteria within mixed populations and be of application to environmental sensing. Acknowledgements We thank the following for generously providing reagents: Kevin O’Connell ECBC, Maryland for antisera and bacteria; Greg Winter laboratory, Cambridge, England for pHEN2; Andreas Plückthun, Zurich, Switzerland for the pAK series of vectors. We are indebted to Mitch Magee of the Texas Center for Infectious Diseases, San Antonio, TX, for the animal procedures. We thank Klaus Linse and staff of the Core Facility, Institute for Cellular and Molecular Biology, University of Texas at Austin for the protein microanalysis work. This work was supported by a Beckman Research Technology Initiative Award (Project No. 26750695), Department of Defense Measurement and Signal Intelligence DOD DAAD17-01-D-001 with the United States Army Research Laboratory and the National Institutes of Health HL66880-02 Subcontract GMO-010207 (to GG). References Berger, F.M., Fukui, G.M., Ludwig, B.J., Rosselet, J.P., 1969. Increased host resistance to infection elicited by lipopolysaccharides from Brucella abortus. Proc. Soc. Exp. Biol. Med. 131, 1376. Boel, E., Bootsma, H., de Kruif, J., Jansze, M., Klingman, K.L., van Dijk, H., Logtenberg, T., 1998. Phage antibodies obtained by competitive selection on complement-resistant Moraxella (Branhamella) catarrhalis recognize the high-molecular-weight outer membrane protein. Infect. Immun. 66, 83. Boschiroli, M.L., Foulongne, V., O’Callaghan, D., 2001. Brucellosis: a worldwide zoonosis. Curr. Opin. Microbiol. 4, 58. Bothmann, H., Pluckthun, A., 1998. Selection for a periplasmic factor improving phage display and functional periplasmic expression. Nat. Biotechnol. 16, 376. Bothmann, H., Pluckthun, A., 2000. The periplasmic Escherichia 195 coli peptidylprolyl cis,trans-isomerase FkpA: I. Increased functional expression of antibody fragments with and without cisprolines. J. Biol. Chem. 275, 17100. Bundle, D.R., Gidney, M.A., Perry, M.B., Duncan, J.R., Cherwonogrodzky, J.W., 1984. Serological confirmation of Brucella abortus and Yersinia enterocolitica O:9 O-antigens by monoclonal antibodies. Infect. Immun. 46, 389. Caroff, M., Bundle, D.R., Perry, M.B., 1984. Structure of the Ochain of the phenol-phase soluble cellular lipopolysaccharide of Yersinia enterocolitica serotype O:9. Eur. J. Biochem. 139, 195. Casey, J.L., Coley, A.M., Tilley, L.M., Foley, M., 2000. Green fluorescent antibodies: novel in vitro tools. Protein Eng. 13, 445. Chen, G., Dubrawsky, I., Mendez, P., Georgiou, G., Iverson, B.L., 1999. In vitro scanning saturation mutagenesis of all the specificity determining residues in an antibody binding site. Protein Eng. 12, 349. Chen, G., Hayhurst, A., Thomas, J.G., Harvey, B.R., Iverson, B.L., Georgiou, G., 2001. Isolation of high-affinity ligand-binding proteins by periplasmic expression with cytometric screening (PECS). Nat. Biotechnol. 19, 537. Coia, G., Ayres, A., Lilley, G.G., Hudson, P.J., Irving, R.A., 1997. Use of mutator cells as a means for increasing production levels of a recombinant antibody directed against Hepatitis B. Gene 201, 203. Corbel, M.J., 1997. Brucellosis: an overview. Emerg. Infect. Dis. 3, 213. de Greeff, A., van Alphen, L., Smith, H.E., 2000. Selection of recombinant antibodies specific for pathogenic Streptococcus suis by subtractive phage display. Infect. Immun. 68, 3949. Deng, S.J., MacKenzie, C.R., Sadowska, J., Michniewicz, J., Young, N.M., Bundle, D.R., Narang, S.A., 1994. Selection of antibody single-chain variable fragments with improved carbohydrate binding by phage display. J. Biol. Chem. 269, 9533. Doern, G.V., 2000. Detection of selected fastidious bacteria. Clin. Infect. Dis. 30, 166. Emanuel, P.A., Dang, J., Gebhardt, J.S., Aldrich, J., Garber, E.A., Kulaga, H., Stopa, P., Valdes, J.J., Dion-Schultz, A., 2000. Recombinant antibodies: a new reagent for biological agent detection. Biosens. Bioelectron. 14, 751. Fernandez-Lago, L., Vallejo, F.J., Trujillano, I., Vizcaino, N., 2000. Fluorescent whole-cell hybridization with 16S rRNA-targeted oligonucleotide probes to identify Brucella spp. by flow cytometry. J. Clin. Microbiol. 38, 2768. Franz, D.R., Jahrling, P.B., Friedlander, A.M., McClain, D.J., Hoover, D.L., Bryne, W.R., Pavlin, J.A., Christopher, G.W., Eitzen Jr., E.M. 1997. Clinical recognition and management of patients exposed to biological warfare agents. JAMA 278, 399. Griffiths, A.D., Malmqvist, M., Marks, J.D., Bye, J.M., Embleton, M.J., McCafferty, J., Baier, M., Holliger, K.P., Gorick, B.D., Hughes-Jones, N.C., et al., 1993. Human anti-self antibodies with high specificity from phage display libraries. EMBO J. 12, 725. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95. Hayhurst, A., 2000. Improved expression characteristics of singlechain Fv fragments when fused downstream of the Escherichia 196 A. Hayhurst et al. / Journal of Immunological Methods 276 (2003) 185–196 coli maltose-binding protein or upstream of a single immunoglobulin-constant domain. Protein Expr. Purif. 18, 1. Hayhurst, A., Georgiou, G., 2001. High-throughput antibody isolation. Curr. Opin. Chem. Biol. 5, 683. Hayhurst, A., Harris, W.J., 1999. Escherichia coli skp chaperone coexpression improves solubility and phage display of singlechain antibody fragments. Protein Expr. Purif. 15, 336. Hilpert, K., Hansen, G., Wessner, H., Kuttner, G., Welfle, K., Seifert, M., Hohne, W., 2001. Anti-c-myc antibody 9E10: epitope key positions and variability characterized using peptide spot synthesis on cellulose. Protein Eng. 14, 803. Hoogenboom, H.R., de Bruine, A.P., Hufton, S.E., Hoet, R.M., Arends, J.W., Roovers, R.C., 1998. Antibody phage display technology and its applications. Immunotechnology 4, 1. Hoogenboom, H.R., Lutgerink, J.T., Pelsers, M.M., Rousch, M.J., Coote, J., Van Neer, N., De Bruine, A., Van Nieuwenhoven, F.A., Glatz, J.F., Arends, J.W., 1999. Selection-dominant and nonaccessible epitopes on cell-surface receptors revealed by cell-panning with a large phage antibody library. Eur. J. Biochem. 260, 774. Iliades, P., Kortt, A.A., Hudson, P.J., 1997. Triabodies: single chain Fv fragments without a linker form trivalent trimers. FEBS Lett. 409, 437. Kaufmann, S.H., Ewing, C.M., Shaper, J.H., 1987. The erasable Western blot. Anal. Biochem. 161, 89. Kerschbaumer, R.J., Hirschl, S., Kaufmann, A., Ibl, M., Koenig, R., Himmler, G., 1997. Single-chain Fv fusion proteins suitable as coating and detecting reagents in a double antibody sandwich enzyme-linked immunosorbent assay. Anal. Biochem. 249, 219. Kittelberger, R., Hilbink, F., Hansen, M.F., Ross, G.P., Joyce, M.A., Fenwick, S., Heesemann, J., Wolf-Watz, H., Nielsen, K., 1995. Serological cross-reactivity between Brucella abortus and Yersinia enterocolitica 0:9 II the use of Yersinia outer proteins for the specific detection of Yersinia enterocolitica infections in ruminants. Vet. Microbiol. 47, 271. Kneissel, S., Queitsch, I., Petersen, G., Behrsing, O., Micheel, B., Dubel, S., 1999. Epitope structures recognised by antibodies against the major coat protein (g8p) of filamentous bacteriophage fd (Inoviridae). J. Mol. Biol. 288, 21. Krebber, A., Burmester, J., Pluckthun, A., 1996. Inclusion of an upstream transcriptional terminator in phage display vectors abolishes background expression of toxic fusions with coat protein g3p. Gene 178, 71. Krebber, A., Bornhauser, S., Burmester, J., Honegger, A., Willuda, J., Bosshard, H.R., Pluckthun, A., 1997. Reliable cloning of functional antibody variable domains from hybridomas and spleen cell repertoires employing a reengineered phage display system. J. Immunol. Methods 201, 35. Lindquist, E.A., Marks, J.D., Kleba, B.J., Stephens, R.S., 2002. Phage-display antibody detection of Chlamydia trachomatis-associated antigens. Microbiology 148, 443. Makowski, L., 1993. Structural constraints on the display of foreign peptides on filamentous bacteriophages. Gene 128, 5. Maynard, J.A., Maassen, C.B., Leppla, S.H., Brasky, K., Patterson, J.L., Iverson, B.L., Georgiou, G., 2002. Protection against anthrax toxin by recombinant antibody fragments correlates with antigen affinity. Nat. Biotechnol. 20, 597. McGregor, D.P., Molloy, P.E., Cunningham, C., Harris, W.J., 1994. Spontaneous assembly of bivalent single chain antibody fragments in Escherichia coli. Mol. Immunol. 31, 219. Moreno, E., Moriyon, I., 2002. Brucella melitensis: a nasty bug with hidden credentials for virulence. Proc. Natl. Acad. Sci. U. S. A. 99, 1. Pearce, L.A., Oddie, G.W., Coia, G., Kortt, A.A., Hudson, P.J., Lilley, G.G., 1997. Linear gene fusions of antibody fragments with streptavidin can be linked to biotin labelled secondary molecules to form bispecific reagents. Biochem. Mol. Biol. Int. 42, 1179. Redkar, R., Rose, S., Bricker, B., DelVecchio, V., 2001. Real-time detection of Brucella abortus, Brucella melitensis and Brucella suis. Mol. Cell. Probes 15, 43. Reiter, Y., Brinkmann, U., Jung, S.H., Lee, B., Kasprzyk, P.G., King, C.R., Pastan, I., 1994. Improved binding and antitumor activity of a recombinant anti-erbB2 immunotoxin by disulfide stabilization of the Fv fragment. J. Biol. Chem. 269, 18327. Rondot, S., Koch, J., Breitling, F., Dubel, S., 2001. A helper phage to improve single-chain antibody presentation in phage display. Nat. Biotechnol. 19, 75. Short, M.K., Jeffrey, P.D., Demirjian, A., Margolies, M.N., 2001. A single H:CDR3 residue in the anti-digoxin antibody 26-10 modulates specificity for C16-substituted digoxin analogs. Protein Eng. 14, 287. Sreevatsan, S., Bookout, J.B., Ringpis, F., Perumaalla, V.S., Ficht, T.A., Adams, L.G., Hagius, S.D., Elzer, P.H., Bricker, B.J., Kumar, G.K., Rajasekhar, M., Isloor, S., Barathur, R.R., 2000. A multiplex approach to molecular detection of Brucella abortus and/or Mycobacterium bovis infection in cattle. J. Clin. Microbiol. 38, 2602. Sumerkan, B., Gokahmetoglu, S., Esel, D., 2001. Brucella detection in blood: comparison of the BacT/Alert standard aerobic bottle, BacT/Alert FAN aerobic bottle and BacT/Alert enhanced FAN aerobic bottle in simulated blood culture. Clin. Microbiol. Infect. 7, 369. Zhou, B., Wirsching, P., Janda, K.D., 2002. Human antibodies against spores of the genus Bacillus: a model study for detection of and protection against anthrax and the bioterrorist threat. Proc. Natl. Acad. Sci. U. S. A. 99, 5241.