* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download The expression of a chromoplast-specific lycopene beta cyclase
Vectors in gene therapy wikipedia , lookup
RNA interference wikipedia , lookup
Biosynthesis wikipedia , lookup
Transposable element wikipedia , lookup
Gene nomenclature wikipedia , lookup
Genetically modified organism wikipedia , lookup
Non-coding DNA wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Secreted frizzled-related protein 1 wikipedia , lookup
Genetic engineering wikipedia , lookup
Gene desert wikipedia , lookup
Point mutation wikipedia , lookup
Plant breeding wikipedia , lookup
Molecular ecology wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
Genomic imprinting wikipedia , lookup
Ridge (biology) wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Community fingerprinting wikipedia , lookup
Gene expression wikipedia , lookup
Expression vector wikipedia , lookup
Gene regulatory network wikipedia , lookup
Molecular evolution wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Journal of Experimental Botany, Vol. 61, No. 1, pp. 105–119, 2010 doi:10.1093/jxb/erp283 Advance Access publication 18 September, 2009 RESEARCH PAPER The expression of a chromoplast-specific lycopene beta cyclase gene is involved in the high production of saffron’s apocarotenoid precursors Oussama Ahrazem1, Angela Rubio-Moraga1, Raquel Castillo López2 and Lourdes Gómez-Gómez1,* 1 Departamento de Ciencia y Tecnologı́a Agroforestal y Genética, ETSIA, Universidad de Castilla-La Mancha, Campus Universitario s/n, E-02071 Albacete, Spain 2 VITAB Laboratorios, Polı́gono Industrial Garysol C/ Pino, parcela 53, La Gineta, E-02110 Albacete, Spain Received 11 June 2009; Revised 27 August 2009; Accepted 30 August 2009 Abstract Crocus sativus is a triploid sterile plant characterized by its long red stigmas, which produce and store significant quantities of carotenoid derivatives formed from the oxidative cleavage of b-carotene and zeaxanthin. The present study reports on the genomic structures of two lycopene-b-cyclase genes, CstLcyB1 and CstLcyB2a, and on their transcription patterns in different C. sativus tissues. Phylogenetic analysis showed that both proteins are located in different groups: CstLcyB2a encodes chromoplast-specific lycopene cyclases, with an expression analysis showing strongly in flower stigmas where it activates and boosts b-carotene accumulation. The CstLcyB1 transcript, however, was present in leaves, tepals, and stigmas at lower levels. In vivo assays in transgenic Arabidopsis demonstrated lycopene b-cyclase activity of CstLcyB2a. CstLcyB2a is a CstLcyB1 paralogue derived through a gene duplication event, while promoter analysis showed that both genes have diverged in their regulatory sequences after duplication. Furthermore, it was found that the CstLcyB2a gene was absent from Crocus kotschyanus and, although present in C. goulimyi and C. cancellatus, the absence of transcripts suggests that transcriptional regulation of CstLcyB2a is responsible for the low apocarotenoid content in these species. Key words: Apocarotenoids, Crocus sativus, gene expression, lycopene, lycopene b-cyclase, promoter, stigma. Introduction Carotenoids are widely distributed isoprenoid pigments fulfilling diverse functions in all taxa (Britton, 1998). Due to their vital role in protecting the photosynthetic apparatus from photo-oxidation, carotenoids are synthesized in all photosynthetic organisms. Moreover, carotenoids represent essential structural components of the light-harvesting antenna and reaction centre complexes (Horton et al., 1996) and are accumulated in many flowers and fruits providing distinct yellow, orange, and red colours, thus contributing substantially to plant–animal communication (Hirschberg, 2001; DellaPenna and Pogson, 2006). In addition, the colours of many carotenoid-accumulating fruits and flowers also contribute to an increase in their economic value (Fraser and Bramley, 2004; Botella-Pavı́a and Rodriguez-Concepción, 2006; Giuliano et al., 2008). Apart from these functions, carotenoids serve as precursors of several physiologically important compounds, synthesized through oxidative cleavage and generally known as apocarotenoids. Representative examples are the ubiquitous chromophore retinal, the phytohormone abscisic acid, and strigolactones (DellaPenna and Pogson, 2006; Leyser, 2008). Carotenoid biosynthesis and its regulation have been studied in various plant species, such as Zea mays (Harjes et al., 2008; Li et al., 2008a, b), Daucus carota (Clotault et al., 2008), Tagetes erecta (Moehs et al., 2001; Del-VillarMartinez et al., 2005), Crocus sativus (Castillo et al., 2005), Prunus armeniaca (Marty et al., 2005), Citrus (Kato et al., 2004; Rodrigo et al., 2004), Gentiana lutea (Zhu et al., 2002, 2003), Arabidopsis (Pogson et al., 1996; Park et al., 2002), * To whom correspondence should be addressed: E-mail: marialourdes.gomez@uclm.es ª The Author [2009]. Published by Oxford University Press [on behalf of the Society for Experimental Biology]. All rights reserved. For Permissions, please e-mail: journals.permissions@oxfordjournals.org 106 | Ahrazem et al. Solanum lycopersicum (Giuliano et al., 1993; Fraser et al., 1994; Ronen et al., 1999; Isaacson et al., 2002), Capsicum annuum (Romer et al., 1993), Nicotiana tabacum (Busch et al., 2002), and in an alga (Steinbrenner and Linden, 2001). These studies have demonstrated that carotenoid accumulation is mainly controlled by the transcriptional regulation of carotenoid biosynthetic genes. Carotenoid biosynthesis and sequestration take place within the plastids of higher plants (reviewed by Cunningham and Gantt, 1998). Carotenoids are C40 isoprenoids that derive from the common C20 precursor, geranygeranyldiphosphate (GGDP). The first committed step in the plastid-localized biosynthetic pathway is mediated by the nuclear-encoded phytoene synthase, which catalyses the formation of phytoene from geranylgeranyl diphosphate (Fig. 1). Phytoene is converted to all-trans lycopene by four desaturation reactions (mediated by phytoene desaturase, PDS, and f-carotene desaturase, ZDS) and by an isomerization reaction mediated by CRTISO and ZISO (Isaacson et al., 2002; Li et al., 2007). The first branch point of this pathway occurs at the cyclization of lycopene, where the action of lycopene beta cyclase (Lcyb) at both ends of the linear lycopene produces a molecule with two b rings, b-carotene. Alternatively, the co-action of Lcyb and lycopene epsilon cyclase (Lcye) generates a-carotene. Beta- and a-carotene are redundantly hydroxylated by non-haem (CHY1, CHY2) as well as cytochrome P450 (CYP97A and CYP97C) hydroxylases. Hydroxylation of b-carotene generates zeaxanthin that is converted to violaxanthin via antheraxanthin by zeaxanthin epoxidase. In the last step of the carotenoid biosynthesis pathway, violaxanthin is transformed into neoxanthin by the activity of the enzyme neoxanthin synthase. Fig. 1. Schematic apocarotenoid biosynthetic pathway in C. sativus stigma. Enzymatic reactions are represented by arrows. GGPP, geranyl geranyl diphosphate; PSY, phytoene synthase; PDS, phytoene desaturase; ZDS, f-carotene desaturase; ZISO and CRTISO, carotene isomerases; LCYe, lycopene e-cyclase; LCYb, lycopene b-cyclase; eCH, e-carotene hydroxylase; ZEP, zeaxanthin epoxidase; VDE, violaxanthin de-epoxidase; NXS, neoxanthin synthase; CCD, carotenoid cleavage dioxygenase; HTTC, 2,6,6-trimethyl-4-hydroxy-1-carboxaldehyde-1-cyclohexene. The conversion of lycopene to b-carotene is catalysed by the b cyclase enzyme (Cunningham et al., 1994; Hugueney et al., 1995; Pecker et al., 1996). The e and b cyclase enzymes are products of related genes, but the e cyclase only adds one e ring to lycopene, whereas the b cyclase can add two b rings. Carotenoids with two e rings are not commonly found in plants. An exception is lactucaxanthin from lettuce. The lettuce Lcye produces the bicyclic e,e-carotene (Cunningham et al., 1996). The lettuce enzyme, together with the e and b cyclases, is similar in sequence to cyanobacterial b cyclase enzymes, and these cyclases are related to another group of carotenoid cyclase enzymes which includes such chromoplast-targeted Lcyb enzymes as the tomato (Ronen et al., 2000) and Citrus enzymes (Alquézar et al., 2009), the capsanthin-capsorubin synthase (Ccs) of pepper (Bouvier et al., 2000), and the neoxanthin synthase (NSY) gene from potato (Al-Babili et al., 2000). Recent data demonstrate a central role for gene duplication in the development of a chromoplast-specific carotenoid biosynthesis pathway (Galpaz et al., 2006; Giorio et al., 2008). Gene and genome duplications have been shown to be particularly prominent in plant genomes and have greatly influenced genomes organization and evolution (Otto and Whitton, 2000; Wendel, 2000; De Bodt et al., 2005; Maere et al., 2005). These duplication events also have profound effects on gene function and regulation. Gene duplication, as an important driving force for generating evolutionary novelty, enables genes to diverge in function or expression through neofunctionalization, where the gene acquires a new function or expression pattern, or subfunctionalization, a process in which functions or expression patterns are partitioned between duplicate genes (Prince and Pickett, 2002), as seems to be the case for the carotenogenic genes in tissues containing chromoplasts. Thus, in order to study the effects of gene duplication and their influence on gene regulation, it is of interest to carry out a comparative analysis of the promoters of these duplicated genes. Saffron, the dried red stigmas of C. sativus, is one of the oldest natural food additives used as a flavouring and a colouring agent. C. sativus is characterized by its long red stigmas, which produce and store significant quantities of carotenoid derivatives, formed from the oxidative cleavage of b-carotene and zeaxanthin (Rubio et al., 2009) (Fig. 1). Interest in the impact of saffron carotenoids on human health is growing due to its high antioxidant capacity (Verma and Bordia, 1998), and recent studies show that saffron may offer some protection against major diseases such as coronary heart diseases and cancer (Abdullaev, 2002). The quantitative and qualitative changes in the carotenoid and the apocarotenoid profile in C. sativus stigmas have been studied previously (Castillo et al., 2005; Rubio et al., 2009), and it has been shown that transcriptional regulation of a b-carotene hydroxylase gene is involved in the observed changes. In this study, the isolation and the characterization of two different lycopene cyclase genes in C. sativus are described in order to study the involvement of these lycopene cyclase genes in the synthesis Saffron LYC subfunctionalization | 107 of b-carotene in C. sativus stigmas and, therefore, in apocarotenoid accumulation. The expression patterns of both genes were followed during stigma development and compared with the changes in the carotenoid levels. In addition, the genomic structure of these genes and their regulation in other Crocus species, which differ in their carotenoid and apocarotenoid content have been studied. Materials and methods Plant material For this study, eight species of Crocus were used. All the specimens were obtained from private collections in the UK (Potterton Nursery). Plant tissues were independently harvested and frozen in liquid nitrogen and stored at –80 C until required. Stigmas were collected at seven developmental stages defined according to Rubio et al. (2008). Seeds of Arabidopsis wild-type, ecotype Columbia (Col), and transgenic lines were sown in pots containing vermiculite and watered with nutrient solution under a controlled environment with 16/8 h light/dark cycles at 22 C. Seeds from transformed Arabidopsis plants were surface-sterilized by rinsing them in 70% (v/v) ethanol for 1 min, followed by a 15 min treatment in 10% (v/ v) bleach+0.05% (v/v) Triton X-100 with three rinses in sterile distilled water. Cloning of C. sativus lycopene cyclase coding genes Genomic DNA extracts were prepared from Crocus leaves by using a CTAB (hexadecyltrimethylammonium bromide) method (Doyle and Doyle, 1990). The genomic sequences were obtained by genome walking with the Universal Genome Walker Kit (Clontech, Palo Alto, CA) using the primers described in Table 1. PCR with gene-specific primers from the identified gDNA clones were used to isolate the full open reading frames. Total RNA was isolated from developing C. sativus stigmas by using Ambion PolyAtrack and following manufacturer’s protocols (Ambion, Inc.). This was done by using 1 lg of poly(A)+ RNA from stigmas to synthesize the first-strand cDNA with a Superscript II reverse transcriptase supplied in the SMART RACE cDNA Amplification Kit (Clontech). The gene-specific primers described in Table 1 were used with the following cycling program: one cycle at 94 C for 3 min, 10 cycles at 94 C for 20 s, 66 C –0.2 C/cycle for 20 s, and 72 C for 2 min, 30 cycles at 94 C for 20 s, 64 C for 20 s, and 72 C for 2 min, and a final extension at 72 C for 5 min. The amplified PCR products were analysed by electrophoresis in 1% agarose gel. The PCR products were then cloned into pGEM-T (Promega, Madison, WI, USA). The ligated DNA was transformed into E. coli strain JM109. The clones (50 colonies) were picked individually and amplified in 3 ml of LB medium at 37 C overnight. The plasmid DNA from each clone was extracted using a DNA plasmid Miniprep kit (Promega, Madison, WI, USA) and then analysed by EcoRI restriction digestion. DNA sequencing and analysis of DNA sequences Plasmids were sequenced using an automated DNA sequencer (ABI PRISM 3730xl, Perkin Elmer) at Macrogen Inc. (Seoul, Korea). Computer analysis of the DNA and amino acid sequences were carried out using the Kalign multiple sequence alignment algorithm (Lassmann and Sonnhammer, 2005). Relative molecular masses were calculated from the deduced amino acid compositions with the Compute Mw tool available at the ExPASy Molecular Biology Web server (Geneva, Switzerland). Subcellular sorting was Table 1. Primer sequences used for CsLcyB1 and CsLcyB2 genes cloning and analysis Primers for CstLcyB1 full-length isolation and RT-PCR expression analysis Primers for CstLcyB2a/b full-length isolation and RT-PCR expression analysis Primers for 3# and 5# RACE-PCRs Primers for promoter isolation and analysis Primers for cloning CstLcyB2a in expression vector cDNAa Sequence 5#–3# LcyB1-f ATGGATCCGCTCTTGAGAAC LcyB1-r LcyB2-f CTATCCTTCTCGTATAGTTCT CATGATGATCTCTAGTCTTCA LcyB2-r LcyB1-f1 LcyB1-f2 LcyB1-r1 LcyB1-r2 LcyB2-f1 LcyB2-f2 LcyB2-r1 LcyB2-r2 P-LcyB1-r1 P-LcyB1-r2 P-LcyB2-r1 P-LcyB2-r2 P-LcyB2-f LcyB2-att-sense TCCACTGTCAATAACAGATCA GCAATGCCCTTCTCTTCAAA TGAAGAGCATTGAAGAGGATGA CATTCCTGCAGTCCTCCAAT TCCCTCCAATCCATGAAGAC TCTTAGCCGAGGTCGAGTCTC AGCGAGAGCTTTGAGAGCG CCATTAGTACCATCTTGTCGA CAGATCGCATCGAAGCAGTCATC AGTGACTTTCTGCCAATTTGTGA TGGGTTCTCAAGAGCGGATCCAT GTCTGGACGTTGGGGTAAGAT GGAAATGAAGACTAGAGATCAT AGGTTAGGACTTGTAAGTTGA GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGA AGGAGATAGAACCATGGCAATCTCTAGTCTTCA GGGGACCACTTTGTACAAGAAAGCTGGGTCCTA TCCACTGTCAATAACAGAT LcyB2-att-antisense a f, forward; r, reverse. 108 | Ahrazem et al. predicted at the PSORT Web server for analysing and predicting protein-sorting signals at the Institute for Molecular and Cellular Biology (Osaka, Japan). Phylogenetic analysis and tree construction was carried out using the Clustal W program at the EBI (http://www.ebi.ac.uk/Tools/clustalw2/index.html), and the Phylodendron program (http://iubio.bio.indiana.edu/treeapp/ treeprint-form.html). Nucleotide replacement (Ka) and synonymous (Ks) substitutions were estimated using the WSPMaker tool (Lee et al., 2008). Expression analysis For RT-PCR, total RNA was isolated from C. sativus anthers, leaves, tepals, and stigma (pre-anthesis), and from the other seven Crocus species stigmas (pre-anthesis) by grinding fresh tissue in liquid nitrogen to a fine powder and extracting in 1 ml of Trizol reagent (Gibco-BRL) per 100 mg of tissue fresh weight, according to the protocol of the manufacturer. The RNA was resuspended in 100 ll of RNase-free water and treated with RQ1 RNase-free DNase (Promega, Madison, WI). The DNase was heat inactivated before RT-PCR. The RNA was quantified with a spectrophotometer at OD of 260 and 280 and stored at –80 C. Various initial concentrations of treated RNA, ranging over 10-fold difference, were used to demonstrate the differential accumulation of the RNA in the tissues analysed in the RT-PCR experiments. Total RNA samples were reverse transcribed with a first-strand cDNA synthesis kit (Amersham Biosciences) and random primers (Promega, Madison, WI, USA). The gene expression levels were evaluated using specific primer pairs for each gene (Table 1). The PCR reactions were carried out using 10 lM of each primer, 200 lM dNTPs, and 2 units of Taq polymerase (Invitrogen). After an initial denaturation step for 2 min, the PCR reactions were performed for 30 cycles at 94 C for 20 s, 58 C for 20 s, and 72 C for 1 min. As an internal control, the mRNA level of the constitutively expressed ribosomal protein 18 was used (Moraga et al., 2004). The program PhotoCaptMw was used to quantify the intensity of the ethidium bromide-stained DNA bands from the positive images of the gel. a dynamic range from ultraviolet to visible region (190–700 nm) set to scan from 250 nm to 540 nm, along with a Sugerlabor Inertsil ODS-2 5-lm C18 column (25034.6 mm), and developed using a methanol, tert-methyl butyl ether gradient system (Fraser et al., 2000). Carotenoids were identified by their retention time, absorption, and fine spectra (Rouseff et al., 1996; Britton, 1998). The carotenoid peaks were integrated at their individual maximum wavelength and their content was calculated using calibration curves of b-carotene (Sigma), lutein (Sigma), and neoxanthin (Extrasynthese). Promoter isolation and comparison Promoters of CstLcyB1 and CstLcyB2a were obtained by genome walking using the Universal Genome Walker Kit (Clontech, Palo Alto, CA) and the primers described in Table 1. Promoters were analysed by the Mobyle programme CONSENSUS for the identification of consensus patterns in unaligned DNA sequences (Hertz and Stormo, 1995) and by FOOTPRINTER (Blanchette and Tompa, 2003). The FOOTPRINTER takes into account the evolutionary relationships and distances between the genes compared (based on a phylogenetic tree). In order to choose adequate motif sizes, we proceeded as previously reported (De Bodt et al., 2005). To compare known sites for transcription factors with those detected by our approach, the Plant-Care (Lescot et al., 2002) database was scanned. For promoter amplification from different Crocus species, the gene-specific primers p-lycB2-f and p-LycB2-r2 described in Table 1 were used, with the following cycling program: one cycle at 94 C for 3 min, 35 cycles at 94 C for 20 s, 50 C for 20 s, and 72 C for 1 min, and a final extension at 72 C for 5 min. The amplified PCR products were analysed by electrophoresis in 1% agarose gel. Results Cloning and sequence analysis of C. sativus cyclases Vector construction and Arabidopsis transformation To produce transgenic plants in which the CstLcyB2a protein was expressed under the control of the 35S promoter, the vector pGWB8 was used (Nakagawa et al., 2007). The strategy followed for cloning CstLcyB2a in this vector was based on Gateway Technology and the oligonucleotides used are indicated in Table 1. The CstLcyB2a cDNA was amplified with the att-primers (Table 1) and introduced into the vector pDONR221 (Invitrogen) by a BP recombination reaction, and from this vector to the plant expression vector pGWB8 by an LR recombination reaction, using Gateway Technology (Invitrogen, Carlsbad, CA). The recombinant pGWB8 vector was transferred into Agrobacterium tumefaciens strain GV3101 by electroporation and bacteria were selected on YEB agar with 50 lg ml1 kanamycin and hygromicin and 100 lg ml1 rifampicin and 25 lg ml1 gentamicin. Arabidopsis plants were transformed by floral dipping (Clough and Bent, 1998) and transformants selected on Murashige and Skoog agar with 50 lg ml1 kanamycin and hygromicin. HPLC analysis of carotenoids extracted from transgenic Arabidopsis lines Extraction of carotenoid pigments was performed as described by Fiore et al. (2006), using canthaxanthin as the internal standard. Carotenoid composition of each sample was analysed by reverse phase HPLC using a Hewlett Packard 1100 HPLC (Palo Alto, CA) connected on line with a photodiode array detector, with As part of an ongoing effort to isolate genes involved in carotenoid biosynthesis in C. sativus stigmas, two partial sequences with homology to carotenoid cyclases were isolated: LcyB1(GenBank accession number AJ888515) and LcyB2 (this work). A genome walker approach allowed the isolation of three full-length gDNA clones, one for LcyB1, CstLcyB1 (GenBank accession number GQ202143); and two for LcyB2, CstLcyB2a (GenBank accession number GQ202141) and CstLcyB2b (GenBank accession number GQ202142). Specific oligonucleotides were generated from the predicted coding region of these three clones and used for RT-PCR experiments on different tissues. Expression was observed only for CstLcyB1 and CstLcyB2a. Comparison of the obtained cDNA sequences with the gDNA sequences revealed no introns. The isolated CstLcyB1 cDNA is 1491 bp, and the predicted amino acid sequence specifies a polypeptide of 497 amino acids in length with a molecular mass of 56.7 kDa. The isolated CstLcyB2a full-length cDNA is 1538 bp. The predicted amino acid sequence specifies a polypeptide of 469 amino acids in length with a molecular mass of 51.94 kDa. The CstLcyB2b shows high homology with CstLcyB2a, but contains a deletion of 78 amino acids close Saffron LYC subfunctionalization | 109 to the N-terminal region (Fig. 2A). The predicted amino acid sequence specifies a polypeptide of 391 amino acids in length with a molecular mass of 43.6 kDa. The substrate and product of lycopene cyclases are hydrophobic, and many carotenogenic enzymes are tightly associated with plastid membranes (Bonk et al., 1997; Cunningham, 2002). Transmembrane region analysis of C. sativus proteins using the SOSUI (Hirokawa et al., 1998) and the TMHMM (Moller et al., 2001) programmes predicted the presence of two transmembrane helices of 23 amino acids (368–390) and (453–475) in CstLcyB1, whereas CstLcyB2a and CstLcyB2b amino acid sequences have no hydrophobic domains. Using other empirically based analyses employing databases of known helical membrane-spanning domains (Hofmann and Stoffel, 1993) it seems that two regions of the plant cyclases are likely to form transmembrane helices in CstLcyB2a and CstLcyB2b. The outer boundaries or limits of the predicted transmembrane helical regions are approximate, and we do not mean to imply that these two regions are certain to form transmembrane helices or that they are the only regions that may do so. Data analysis with the PSORT programme (Horton et al., 2006) predicted a plastid location for both proteins. Transit peptides of 54 bp and 23 bp were predicted for CstLcyB1 and CstLcyB2a, respectively (Fig. 2A). The C. sativus proteins CstLcyB1 and CstLcyB2a contain a domain close to the Nterminus that bind dinucleotides as NAD(P) or FAD, with the characteristic amino acid sequence DX4GXGXAX4A (Wierenga et al., 1986; Cunningham et al., 1994), which is missing in the CstLcyB2b protein (Fig. 2A), although all three contain four further motifs with unknown function (Fig. 2A) (Krubasik and Sandman, 2000), but probably involved in their catalytic activity (Cunningham et al., 1996). CstLcyB1 exhibited 79% identity at the amino acid level with a Vitis vinifera lycopene b-cyclase (CAN69313) and 77% and 71% identity with the characterized citrus and tomato lycopene b-cyclases. However, CstLcyB2a and CstLcyB2b are similar to chromoplast specific lycopene-b-cyclases such as the tomato (Ronen et al., 2000) and Citrus (Alquézar et al., 2009), to the pepper capsanthin–capsorubin synthase (Ccs) (Bouvier et al., 1994), and to the neoxanthin synthase gene from potato (Al-Babili et al., 2000) (Fig. 2B). Phylogenetic analysis based on the alignment of available full-length protein sequences of plant lycopene cyclases show three main branches corresponding to b-cyclases, e-cyclases, and a third branch containing Ccs (Bouvier et al., 1994), which also possesses a lycopene b-cyclase activity (Hugueney et al., 1995), the neoxanthin synthase enzyme from Solanum tuberosum (Al-Babili et al., 2000), the tomato chromoplast-specific b-cyclase gene (Ronen et al., 2000), and the chromoplastspecific lycopene b-cyclase from Citrus (Alquézar et al., 2009), in addition to other plant enzymes with activities yet to be characterized (Fig. 2B). Driving forces for genetic divergence A common origin by duplication of an ancestral Lcy-B gene has been proposed for chromoplast-specific b-cyclases (Krubasik and Sandmann, 2000). To explore whether Darwinian positive selection was involved in driving gene divergence of CstLcyB1 and CstLcyB2a after duplication, the number of synonymous substitutions per synonymous site, Ks, and the number of non-synonymous substitutions per non-synonymous site, Ka, between both genes were analysed. The level of replacement and synonymous site nucleotide divergence ratio (Ka/Ks¼0.1943) indicates that this gene pair is likely to be undergoing a purifying selection, which strongly indicates high function constraint of protein evolution. To detect interesting evolutionary signatures, subregions of both protein-coding DNA sequences were scanned and the selection pressure calculated (estimated by Ka/Ks) (Fig. 3). The output showed many grey-coloured regions, indicating that these regions have undergone neutral evolution. However, there were exceptions in some regions, where the red colour indicated Ka/Ks values higher than one, hence suggesting that these regions have undergone amino acid fixations during evolution, a fact that indicates that these particular positions are functionally important. These regions do in fact codify for domains involved in catalytic activity (Fig. 2A). Stable expression of the CstLcyB2a gene in Arabidopsis thaliana The function of lycopene-b-cyclase has been demonstrated for many of the enzymes shown in the phylogenetic tree (Fig. 2B). However, the activity of the enzymes present in the CstLcyB2a and CstLcyB2b group seems to be more heterogeneous. Therefore, the function of the CstLcyB2a enzyme in transgenic Arabidopsis plants was assayed. In a first approach, lycopene-accumulating E. coli cells, carrying a lycopene biosynthetic plasmid (pACCRT-EIB; Misawa and Shimada, 1998) were cotransfected with plasmids expressing the cDNA of CstLcyB2a and CstLcyB2b. Carotenoids were extracted and analysed by HPLC. Expression of CstLcyB2a brought about synthesis of b-carotene in E. coli, whereas the CstLcyB2b was unable to transform lycopene into b-carotene (data not shown). Due to these results, Agrobacterium tumefaciens-mediated transformation of Arabidopsis flowers (Col-0) was performed only with the plasmid CstLcyB2a-pGWB8, in which CstLcyB2a was driven by the cauliflower mosaic virus (CaMV) 35S constitutive promoter. Transgenic plants showed no morphological difference from untransformed plants. In order to determine the carotenoid alteration generated by the overexpression of CstLcyB2a, carotenoids were extracted from 6-d-old transgenic seedlings (15 seedlings per line in three batches of five) and analysed by HPLC. Eight transgenic (T3) lines were analysed, with two of them showing carotenoid levels similar to the wild type; whereas the other six showed increase accumulation of b-carotene, with three of these six showing an increase in lutein content (Fig. 4). In none of the transgenic lines were the levels of neoxanthin and violaxanthin significantly affected (data not shown) suggesting the lack of neoxanthin synthase activity for CstLcyB2a. 110 | Ahrazem et al. Fig. 2. Characteristics of the saffron beta lycopene cyclase proteins. (A) Alignment of deduced amino acid sequences of CstLcyB2a, CstLcyB2b, and CstLcyB1 using the Kalign multiple sequence alignment algorithm. Numbers on the left denote the number of amino acid residues. Residues identical for all sequences in a given position are in white text on a black background, those identical in two of the three or similar in the three sequences are on a grey background. The most likely points for chloroplast precursor cleavage are indicated with arrows. Characteristic regions of plant LCYs are indicated as boxes, the di-nucleotide binding signature, motifs (M) I to IV (Hugueney et al., 1995; Cunningham et al., 1996). (B) Unrooted phylogenetic tree based on the amino acid sequences of algae and plant lycopene cyclase proteins. Only full-length members of the family are included. The predicted protein sequences were initially clustered using ClustalW. Accession numbers for non-photosynthetic plant b-cyclases: Capsicum annuum, Q42435; Citrus sinensis AAF18389; Daucus carota, ABB52072; Solanum lycopersicum, AAG21133; Solanum tuberosum, CAB92977; Crocus sativus-a (CstLcyB2a), GQ202141; Crocus sativus-b (CstLcyB2b), GQ202142. Accession numbers for alga b-cyclases: Haematococcus pluvialis, AY182008; Dunaliella salina, ACA34344. Accession numbers for plant e-cyclases: Arabidopsis thaliana, AAF82389; Vitis vinifera, CAN68182.1; Citrus sinensis, AA548096; Adonis palestina, AAK07431.1; Solanum lycopersicum, ACB28618. Accession numbers for plant Saffron LYC subfunctionalization | 111 Expression analysis of CstLcyB1 and CstLcyB2a The expression pattern of both genes was examined in different organs. CstLcyB1 was highly expressed in leaves and stigma tissue, and at lower levels in tepals (Fig. 5A). By contrast, CstLcyB2a was only detected in the stigma tissue (Fig. 5A). Under the conditions tested the expression of CstLcyB2b could not be detected. During the development of C. sativus, stigmas change in colour from white to scarlet, passing through the yellow and orange stages. These changes parallel stigma growth and carotenoid and apocarotenoid accumulation (Castillo et al., 2005; Rubio et al., 2009). The carotenoid b-carotene was already detected in the yellow and orange stages, but reached its highest levels in the scarlet stages. Due to the active accumulation of b-carotene in C. sativus stigmas, and the high expression levels detected in the tissue for CstLcyB2a, RT-PCR analysis was performed with RNA isolated from different stages of stigma development. The CstLcyB2a transcript was detected in all the stages, with the highest levels of expression in the days previous to anthesis (Fig. 5B). The expression levels of CstLcyB1 were also followed and transcripts were detected in the red and preanthesis stages (Fig. 5B). The levels were much lower than the ones observed for CstLcyB2a. Promoter divergence after duplication in C. sativus In order to determine the origin of the differential expression of both genes, the promoter region of CstLycB1 and CstLycB2a genes was isolated and analysed. In silico promoter analysis (Table 2) showed that CstLcyB1 possesses several motifs involved in stress response such as defense/stress responsiveness, MeJA, ABA, anoxia, and light responsiveness. By contrast, the CstLycB2a promoter possesses motifs involved in ABA, light responsiveness, and circadian regulation. This result suggests that while both genes are involved in b-carotene biosynthesis, CstLcyB1 expression might be modulated under biotic stress conditions. In addition, these promoters were compared with other promoter sequences from different LycB genes and the Ccs gene (Fig. 6A). Sequence analysis of CstLycB1 and CstLycB2a promoters revealed the lack of similarity between both promoters. Interestingly, the phylogenetic analysis showed that promoters of chromoplast specific Lycb genes grouped together, with the exception of Citrus, where both promoters showed a 51% identity. The promoters for the chromoplast-specific genes were extracted and analysed for conserved motifs. The number of motifs uncovered among Citrus, Crocus, and tomato or pepper reflects the difference in the overall degree of conservation (Fig. 6B). No motifs of size 11 bp or 12 bp were detected among the promoters analysed due to the increase in nucleotide substitutions, reflecting promoter divergence. In addition, the promoters of CYC-b from tomato and Ccs from pepper were clearly more conserved than the other two promoters showing a one-to-one relationship, as seven motifs of size 10 bp can be uncovered, while only five and two of these seven conserved motifs can be identified in the other two promoters (Fig. 6B). Promoter structure and expression of the specific lycopene cyclase in Crocus species with different stigma colours Due to the specific expression of CstLcyB2a in the stigma tissue, its expression patterns were analysed in different Crocus species before anthesis. These expression patterns are characterized by their different carotenoid concentration and composition (Castillo et al., 2005) along with a great Fig. 3. WSPMarker results for lycopene cyclase genes. The calculated Ka/Ks ratios are plotted as slim bars within a sliding window size of nine nucleotides. b-cyclases: Cryptomeria japonica, BAE43526; Narcissus pseudonarcissus, Q40424; Adonis palestina, AAK07430; Citrus sinensis, AAR89632; Sandersonia aurantica, AAL92175; Daucus carota, ABB52071; Capsicum annuum, Q43415; Solanum lycopersicum, Q43503; Gentiana lutea, ABK57115; Arabidopsis thaliana, NP_187634; Vitis vinifera, CAO23330; Lycium barbarum, AAW88382; Medicago truncatula, ABN07986; Carica papaya, ABD91578; Nicotiana tabacum, Q43578; Tagetes erecta, AAG10429; Oryza sativa, BAD16478; Bixa orellana, CAD70565; Zea mays, AAO18661; Crocus sativus (CstLcyB1), GQ202143. 112 | Ahrazem et al. deletions and changes (data not shown). The promoter region was not amplified from C. kotschyanus. Discussion Fig. 4. Transgenic T3 CstLcyB2a Arabidopsis plants showed increased levels of b-carotene. Comparison of b-carotene and lutein content from cotyledon extracts of wild-type and eight transgenic plants (line 4, 1, 17, 12, 18, 23, 19, and 15). Data represent the average of b-carotene and lutein content (6SD) of three batches of five seedlings each per transgenic line. variety in stigma coloration (Fig. 7A). C. goulimyi has a pale yellow stigma primarily due to a low concentration of total carotenoids, with only phytofluene and f-carotene detected after HPLC profile magnification (Castillo et al., 2005). The same was observed for C. kotschyanus (data not shown), which has a stigma similar in colour to C. goulimyi (Fig. 7A). C. cancellatus showed high levels of phytofluene and f-carotene, and low levels of b-carotene were detected only after HPLC profile magnification (Castillo et al., 2005). The pattern for C. medius is similar but low levels of b-carotene have been detected without HPLC profile magnification. By contrast, C. pallasii, C. hadriaticus, C. cartwrightianus, and C. sativus all have a dark red stigmas and showed a high carotenoid content in b-carotene (Castillo et al., 2005). Transcripts for CstLcyB1 were detected in all the stigmas tested with the exception of C. goulimyi and C. kotschyanus (Fig. 7B). High expression levels of CstLcyB2a were detected in C. hadriaticus, C. cartwrightianus, C. pallasii, and C. sativus. By contrast, the transcript of CstLcyB2a was undetectable in C. goulimyi, C. kotschyanus, and C. cancellatus (Fig. 7B). The presence of CstLcyB2a homologues in these species was determined by PCR amplification over gDNA, and only for C. kotschyanus was no amplification product obtained. By contrast, the CstLcyB1 gene was detected in all the samples tested (Fig. 7C). The PCR products obtained for both genes from the analysed species were sequenced and compared with the products obtained by RT-PCR, which do correspond to the expected genes. To investigate further the absence of expression of CstLcyB2a in C. goulimyi and C. cancellatus, the promoter regions of different Crocus species were examined to determine whether defects in the promoter structure could account for the observed differences. As shown in Fig. 7D, genomic PCR analysis of the different Crocus samples reveals that the CstLcyB2a promoter region is equivalently sized in C. sativus, C. hadriaticus, C. pallasi, C. cartwrightianus, and C. medius but differs in C. goulimyi and C. cancellatus, whose promoter regions showed multiple The increasing characterization of carotenogenic enzymes that are specifically expressed in chromoplastic tissues represents an important breakthrough for the study of carotenogenesis regulation in these tissues of high economic value. In the case of lycopene cyclation, it represents a key branching point in the carotenoid biosynthetic pathway that profoundly affects carotenoid composition (Cunningham, 2002). C. sativus stigmas are characterized by the massive accumulation of apocarotenoids derived from zeaxanthin and b-carotene cleavage (Rubio et al., 2009). In this work, the isolation of two different lycopene cyclase genes, namely CstLcyB1 and CstLcyB2a is reported. CstLcyB2a was expressed in the stigma tissue where it seems to play a major function in the massive apocarotenoid biosynthesis and accumulation. The expression analysis of CstLcyB2a in different Crocus species indicates that transcriptional regulation of this gene affects carotenoid and apocarotenoid content in the stigma tissue. Furthermore, analysis of the promoter region indicates that its structure determines whether or not high levels of total apocarotenoids are produced in the different Crocus species. Thus, these species are useful experimental models to investigate the molecular mechanism regulating carotenoid concentration and composition in the stigma. The polypeptides of CstLcyB1 and CstLcyB2a differ in size, and their amino acid sequence is only 47% identical. Phylogenetic analysis of CstLcyB1 and CstLcyB2a showed that both are present in different groups: CstLcyB1 was related to the initially characterized group of LcyBs whereas CstLcyB2 was more closely related to chromoplastic cyclases (CYC-B and CCS). Although two different CstLycB2 genes were isolated, CstLycB2a and CstLycB2b, the CstLycB2b protein showed a deletion of 78 aa in the N-terminal region, which contains the dinucleotide binding signature, an important domain present in all the LycB enzymes. Furthermore, expression for CstLycB2b in the tissues analysed could not be detected, and protein expression assays did not show any activity, thus suggesting that CstLycB2b is not a functional gene in C. sativus. By contrast, CstLycB2a showed lycopene b-cyclase activity in transgenic Arabidopsis plants, which showed increased levels of b-carotene. In several transgenic lines, an increase in lutein levels was observed, which is in agreement with previous observations suggesting that LCYe activity is not rate-limiting for lutein levels (Diretto et al., 2006; Yu et al., 2008). The expression of CstLcyB2a was restricted to the stigma tissue, while the up-regulation of the CstLcyB2a gene parallels b-carotene accumulation and the massive accumulation of apocarotenoids in the stigma tissue of C. sativus (Castillo et al., 2005; Rubio et al., 2009). The presence of two LcyB genes, one with a chromoplast-specific expression, has previously been reported in other carotenogenic tissues, mainly in fruits. The CYC-B gene from tomato is Saffron LYC subfunctionalization | 113 Fig. 5. Expression analysis of CstLcyB1 and CstLcyB2a by RT-PCR in different tissues. (A) Expression levels in leaves, stigma, tepals, and anthers and relative transcript levels (normalized to 18S rRNA) were determined by reverse transcriptase (RT)-PCR. (B) Stigma tissue of C. sativus in different developmental stages: yellow (Y), orange (O), red (R), one day before anthesis (–1da), anthesis (da), two days after anthesis (+2da), and three days after anthesis (+3da) and relative transcript levels (normalized to 18S rRNA) determined by reverse transcriptase (RT)-PCR. All the RT-PCR experiments were repeated three times, and representative results are shown. The RPS18 gene for 18S RNA was amplified as a control. The PCR products were separated by 1% (w/v) agarose gel electrophoresis and visualized by ethidium bromide staining. transiently expressed in fruit and petals, whereas it is undetectable in roots, leaves, and stem (Ronen et al., 2000). The orthologous CYC-B gene from watermelon might be an essential flesh colour determinant in this fruit (Tadmor et al., 2005), while in orange the Csb-LCY2 plays a key role in the carotenogenesis of citrus fruits by redirecting the flux of carotenes into the b,b-branch to lead to the accumulation of xanthophylls characteristic of orange fruit ripening (Alquezar et al., 2009). Therefore, the involvement of a second chromoplastic-specific LcyB gene in the regulation of carotenoid composition appears to be a frequent mechanism in carotenoid rich tissues. Interestingly, no homologues to this chromoplast specific lycopene b-cyclases have been identified in Arabidopsis and rice whose genomes are fully sequenced, probably due to the absence of tissues rich in carotenoids in these species. Although the complete genome has been duplicated several times in both plants in their evolutionary past, fewer than 27% of A. thaliana (Blanc et al., 2003) and 15.4% of rice genes (Wu et al., 2008) have been retained as duplicates. In fact, loss is the most likely fate of a duplicated gene (Walsh, 1995; Lynch and Connery, 2003), and retention has often been explained by functional divergence occurring by either neo- or subfunctionalization. Among the groups of duplicated genes with high retention rates are those involved in secondary metabolism (Maere et al., 2005). Evolutionarily, a common origin by duplication of an ancestral Lcy-B gene has been proposed for chromoplast-specific b-cyclases (Krubasik and Sandmann, 2000). Retention of both genes could be explained by a selective advantage acquired through the functionally redundant activity of duplicated genes (Osborn et al., 2003) increasing the levels of the gene product in 114 | Ahrazem et al. Table 2. List of motifs found in the promoter regions of CstLcyB1 and CstLcyB2a genes Motif Sequence Function CstLcyB1 promoter a CstLcyB2a promoter a A-Box CCAAT-box Circadian GA motif GT1-motif G-Box MNF1 Sp1 CATT motif GAG motif W-box CCGTCC CAACGG CAANNNNATC AAGGAAGA GGTTAA CACGTG/CACGTT GTGCCC(A/T)(A/T) CC(G/A)CCC GCATTC GGAGATG TTGACC – – – – – x x x x x x X x x x x x x x – – – Box-W1 TTGACC x – ARE CGTCA-motif TGACG-motif ABRE TATA BOX CAAT box TGGTTT CGTCA TGACG CACGTG Cis-acting regulatory element MYBhv binding site Circadian regulation Light response element Light response element Light responsiveness Light response element Light response element Light response element Light response element Elicitor, wounding and pathogen response element Fungal elicitor response element Anoxia response element MeJA response element MeJA response element ABA responsiveness Core promoter element Common cis-acting element x x x x x x – – – x x x a x, Present; –, absent. Fig. 6. Promoter analysis of lycopene cyclase genes. (A) Phylogenetic tree of lycopene b-cyclases, the Ccs and chromoplast-specific lycopene b-cyclases genes generated by multiple alignments of the nucleotide sequences in the 5#-upstream region. The accession numbers used are: Citrus Csb-Lcy1, AY094582.1; Citrus Csb-Lcy2, AF169241; pepper Ccs, DQ907615.1; tomato CYCb, AC2110461; Carica papaya CpLcyb1, DQ415894.1; Medicago truncatula MtLcyb1, AC153128.1; Arabidopsis thaliana AtLcyb AC009400.4; Oryza sativa OsLcyb, AP005849.3; Zea mays ZmLcyb, AC265536; C. sativus CstLcyb1, GQ202145, and C. sativus CstLcyb2-a, GQ202145. (B) Visual representation of motifs detected by FOOTPRINTER in the promoters of Ccs pepper and Citrus, tomato, and Crocus chromoplastspecific lycopene b-cyclases (FOOTPRINTER parameters: motif size: 10, allowed mutations 2, losses). a particular tissue or time (Force et al., 1999; Osborn et al., 2003). Therefore, recruitment of carotenoid metabolism in plant tissues with a high carotenoid content could have occurred later on in evolution through gene subfunctionalization, suggesting it was the case for CstLcyB2a during stigma development and for CYC-B and Csb-LCY2 during Saffron LYC subfunctionalization | 115 Fig. 7. Pigmentation levels of stigmas from different Crocus species are associated with CstLcyB2a transcript accumulation. (A) Photographs showing the external pigmentation of stigmas of several Crocus species: from left to right and from top to bottom: C. cancellatus, C. hadriaticus, C. cartwrightianus, C. sativus, C. pallasii, C. goulimyi, C. medius, and C. kotschyanus. (B) Detection of CstLcyB1 and CstLcyB2a transcripts by RT-PCR in preanthesis stigmas in different Crocus species and relative transcript levels (normalized to 18S rRNA). Number from 1 to 8 correspond to: C. cancellatus, C. hadriaticus, C. cartwrightianus, C. sativus, C. pallasii, C. goulimyi, C. medius, and C. kotschyanus. The levels of constitutively expressed RPS18 coding gene were assayed as controls. (C) PCR amplification of CstLcyB1 and CstLcyB2a genes from the genomes of the indicated Crocus species. Both genes were amplified in the genomic region corresponding to their cDNAs. (D) PCR amplification of the CstLcyB2a promoter from the genomes of the indicated Crocus species. Promoters were amplified from a region corresponding to 759 bp upstream of the translational start site (GenBank GQ202144) of C. sativus promoter. The PCR products were separated by 1% (w/v) agarose gel electrophoresis and visualized by ethidium bromide staining. fruit development. The acquisition of distinct expression patterns could be explained by the analysis of the respective promoters. The results obtained indicate that similar gene expression patterns should be expected for the most conserved promoters, a fact which has been experimentally confirmed for the tomato and pepper genes (Hugueney et al., 1995; Ronen et al., 2000). The poor degree of conservation of the analysed promoters with the Crocus sequence suggests that it has acquired distinct expression patterns, as confirmed in the present study, with high expression levels in the stigma tissue. In previous studies, it was found that Crocus species showing dark red stigmas accumulate increasing levels of total carotenoids and apocarotenoids during development, whereas Crocus species with non-dark red stigmas accumulate lower levels of total carotenoids and apocarotenoids. The observed expression patterns of CstLcyB2a in different Crocus species suggest that previously observed b-carotene and apocarotenoid accumulation (Castillo et al., 2005; Rubio et al., 2009) were regulated, in part, at CstLcyB2a transcriptional level, together with b-carotene hydroxylase 1 (Castillo et al., 2005). Nevertheless, it should be noted that, in the case of the species in which CstLycB2a transcripts were absence, the accumulation of phytofluene and f-carotene suggests that upstream enzymes in the pathway are also affected, and that the chromoplast-specific pathway in these species has been lost during evolution. Our current data, which indicates that the expression levels of the carotenoid biosynthetic genes are the key regulators of the high levels of total carotenoid accumulation in Crocus stigmas, are in good agreement with previous results obtained in other tissues of different plants. In other carotenogenic tissues such as fruits, the regulation of chromoplast specific lycopene b-cyclase has been shown to be critical in the specific accumulation of b-carotene in tomato (Ronen et al., 2000). The pale orange coloration of Beta mutant fruits is due to an important increase in the transcription of this gene, which leads to a higher accumulation of b-carotene than in wild-type fruit. By contrast, the old-gold mutant carries a null allele of this chromoplast specific LcyB resulting in a reduction of b-carotene (Ronen et al., 2000). In pepper, the high expression levels of the Ccs gene are correlated with high levels of capsanthin (Bouvier et al., 1994). In Citrus, the up-regulation of a chromoplast specific lycopene cyclase gene, Csb-LCY2, parallels the massive accumulation of b,b-xanthophylls accompanying orange fruit maturation (Rodrigo et al., 2004). Several genetic studies have shown the relationship between the presence of structural genes for carotenoid biosynthesis and the phenotypic variability in carotenoid accumulation (Thorup et al., 2000; Wong et al., 2004; Tadmor et al., 2005; Harjes et al., 2008; Alquézar et al., 2009). In Crocus, the relationship between the presence of the CstLcyB2 transcript and the phenotypic variability in stigma colours is due to alterations in the gene structure. A similar phenomenon has been found in the tomato CYC-B gene (Ronen et al., 2000). In pepper, several studies have reported that the Ccs gene is either deleted or mutated in yellow cultivars (Popovsky and Paran, 2000; Ha et al., 116 | Ahrazem et al. 2007). In watermelon, polymorphisms in the coding region of LcyB are determinant of the yellow or red flesh coloration (Bang et al., 2007) while in red grapefruit amino acid alterations are likely to be involved in the loss of activity of a b-LCY2b Citrus allele (Alquézar et al., 2009). The absence of coding and genomic regions of LcyB2a in C. kotschyanus has no phenotypic manifestation in leaves and stems, indicating that LcyB2a plays a dispensable role in vegetative tissues under normal growth conditions, as has been observed in the old gold tomato mutant (Ronen et al., 2000) and in Star Ruby grapefruit (Alquézar et al., 2009). In C. goulimyi and C. cancellatus, although the coding sequence of LcyB2a was present, multiple deletions in the promoter seem to impair the promoter activity. In summary, two lycopene cyclase genes from C. sativus, CstLcyB1 and CstLcyB2a have been identified and characterized. Based on the low sequence identity to each other, it is likely that this gene pair arose from an old gene duplication event. The absence of LcyB2 orthologues in plants that do not accumulate high levels of carotenoids suggests that LcyB2 is a LcyB1 paralogue that acquired a new expression pattern by subfunctionalization, which allows a tight and timely control over the synthesis of carotenoids in specific tissues. In the stigma tissue, transcript levels of CsLcyB2a were found to correlate positively with stigma carotenoid content in genetically diverse Crocus, suggesting that the major regulatory control of carotenogenesis in this tissue is at the transcriptional level. Acknowledgements We thank T Goode for Crocus photographs, and KA Walsh (Escuela Técnica Superior de Ingenieros Agrónomos, Universidad de Castilla-La Mancha, Albacete, Spain) for language revision. This work was supported by the Ministerio de Educación y Ciencia (BIO2006/00841) and Consejerı́a de Educación y Ciencia (PAI08-0211-6481). References Abdullaev FI. 2002. Cancer chemopreventive and tumoricidal properties of saffron (Crocus sativus L.). Experimental Biology and Medicine (Maywood, NJ) 227, 20–25. Al-Babili S, Hugueney P, Schledz M, Welsch R, Frohnmeyer H, Laule O, Beyer P. 2000. Identification of a novel gene coding for neoxanthin synthase from Solanum tuberosum. FEBS Letters 485, 168–712. Alquézar B, Zacarias L, Rodrigo MJ. 2009. Molecular and functional characterization of a novel chromoplast-specific lycopene b-cyclase from Citrus and its relation to lycopene accumulation. Journal of Experimental Botany 60, 1783–1797. Bang H, Kim S, Leskovar D, King S. 2007. Development of a codominant CAPS marker for allelic selection between canary yellow and red watermelon based on SNP in lycopene b-cyclase (LCYB) gene. Molecular Breeding 20, 63–72. Blanc G, Hokamp K, Wolfe K. 2003. A recent polyploidy superimposed on older large-scale duplications in the Arabidopsis genome. Genome Research 13, 137–144. Blanchette M, Tompa M. 2003. FootPrinter: a program designed for phylogenetic footprinting. Nucleic Acids Research 31, 3840–3842. Bonk M, Hoffmann B, Von Lintig J, Schledz M, Al-Babili S, Hobeika E, Kleinig H, Beyer P. 1997. Chloroplast import of four carotenoid biosynthetic enzymes in vitro reveals differential fates prior to membrane binding and oligomeric assembly. European Journal of Biochemistry 247, 942–950. Botella-Pavı́a P, Rodrı́guez-Concepción M. 2006. Carotenoid biotechnology in plants for nutritionally improved foods. Physiologia Plantarum 126, 369–381. Bouvier F, D’harlingue A, Backhaus RA, Kumagai MH, Camara B. 2000. Identification of neoxanthin synthase as a carotenoid cyclase paralog. European Journal of Biochemistry 267, 6346–6352. Bouvier F, Hugueney P, d’Harlingue A, Kuntz M, Camara B. 1994. Xanthophyll biosynthesis in chromoplasts: isolation and molecular cloning of an enzyme catalyzing the conversion of 5,6epoxycarotenoid into ketocarotenoid. The Plant Journal 6, 45–54. Britton G. 1998. Overview of carotenoid biosynthesis. In: Britton G, Liaaen-Jensen S, Pfander H, eds. Biosynthesis and metabolism, Vol. 3. Basel: Birkhäuser Verlag, 13–148. Busch M, Seuter A, Hain R. 2002. Functional analysis of the early steps of carotenoid biosynthesis in tobacco. Plant Physiology 128, 439–453. Castillo R, Fernández JA, Gómez-Gómez L. 2005. Implications of carotenoid biosynthetic genes in apocarotenoid formation during the stigma development of Crocus sativus and its closer relatives. Plant Physiology 139, 674–689. Clotault J, Peltier D, Berruyer R, Thomas M, Briard M, Geoffriau E. 2008. Expression of carotenoid biosynthesis genes during carrot root development. Jounal of Experimental Botany 59, 3563–7353. Clough SJ, Bent AF. 1998. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. The Plant Journal 16, 735–743. Cunningham FX. 2002. Regulation of carotenoid synthesis and accumulation in plants. Pure and Applied Chemistry 74, 1409–1417. Cunningham FX, Gantt E. 1998. Genes and enzymes of carotenoid biosynthesis in plants. Annual Review of Plant Physiology and Plant Molecular Biology 49, 557–583. Cunningham FX, Pogson B, Sun Z, McDonald KA, DellaPenna D, Gantt E. 1996. Functional analysis of the beta and epsilon lycopene cyclase enzymes of Arabidopsis reveals a mechanism for control of cyclic carotenoid formation. The Plant Cell 8, 1613–1626. Cunningham Jr FX, Sun Z, Chamovitz D, Hirschberg J, Gantt E. 1994. Molecular structure and enzymatic function of lycopene cyclase from the cyanobacterium Synechococcus sp. strain PCC7942. The Plant Cell 6, 1107–1121. De Bodt S, Maere S, Van de Peer Y. 2005. Genome duplication and the origin of angiosperms. Trends in Ecology and Evolution 20, 591–597. Saffron LYC subfunctionalization | 117 DellaPenna D, Pogson BJ. 2006. Vitamin synthesis in plants: tocopherols and carotenoids. Annual Review of Plant Biology 57, 711–738. Del Villar-Martı́nez AA, Garcı́a-Saucedo PA, Carabez-Trejo A, Cruz-Hernández A, Paredes-López O. 2005. Carotenogenic gene expression and ultrastructural changes during development in marigold. Journal of Plant Physiology 162, 1046–1056. Diretto G, Tavazza R, Welsch R, Pizzichini D, Mourgues F, Papacchioli V, Beyer P, Giuliano G. 2006. Metabolic engineering of potato tuber carotenoids through tuber-specific silencing of lycopene epsilon cyclase. BMC Plant Biology 26, 6:13. Doyle JJ, Doyle LH. 1990. Isolation of plant DNA from fresh tissue. Focus 12, 13–15. Fiore A, Dall’Osto L, Fraser P, Bassi R, Giuliano G. 2006. Elucidation of the b-carotene hydroxylation pathway in Arabidopsis thaliana. FEBS letters 580, 4718–4722. Force A, Lynch M, Pickett FB, Amores A, Yan YL, Postlethwait J. 1999. Preservation of duplicate genes by complementary, degenerative mutations. Genetics 151, 1531–1545. Hirschberg J. 2001. Carotenoid biosynthesis in flowering plants. Current Opinion in Plant Biology 4, 210–218. Hirokawa T, Boon-Chieng S, Mitaku S. 1998. SOSUI: classification and secondary structure prediction system for membrane proteins. Bioinformatics 14, 378–379. Hofmann K, Stoffel W. 1993. A database of membrane spanning protein segments. Biological Chemistry Hoppe-Seyler 374, 166. Horton P, Park K-J, Obayashi T, Nakai K. 2006. Protein subcellular localization prediction with WoLF PSORT. Proceedings of Asian Pacific Bioinformatics Conference, Taipei, Taiwan. Horton P, Ruban AV, Walters RG. 1996. Regulation of light harvesting in green plants. Annual Review of Plant Physiology and Plant Molecular Biology 47, 655–684. Hugueney P, Badillo A, Chen HC, Klein A, Hirschberg J, Camara B, Kuntz M. 1995. Metabolism of cyclic carotenoids: a model for the alteration of this biosynthetic pathway in Capsicum annuum chromoplasts. The Plant Journal 8, 417–424. Fraser PD, Bramley PM. 2004. The biosynthesis and nutritional uses of carotenoids. Progress in Lipid Research 43, 228–265. Isaacson T, Ronen G, Zamir D, Hirschberg J. 2002. Cloning of tangerine from tomato reveals a carotenoid isomerase essential for production of b-carotene and xanthophylls in plants. The Plant Cell 14, 333–342. Fraser PD, Pinto ME, Holloway DE, Bramley PM. 2000. Technical advance: application of high-performance liquid chromatography with photodiode array detection to the metabolic profiling of plant isoprenoids. The Plant Journal 24, 551–558. Kato M, Ikoma Y, Matsumoto H, Sugiura M, Hyodo H, Yano M. 2004. Accumulation of carotenoids and expression of carotenoid biosynthetic genes during maturation in Citrus fruit. Plant Physiology 134, 824–837. Fraser PD, Truesdale MR, Bird CR, Schuch W, Bramley PM. 1994. Carotenoid biosynthesis during tomato fruit development. Plant Physiology 105, 405–413. Krubasik P, Sandmann G. 2000. Molecular evolution of lycopene cyclases involved in the formation of carotenoids with ionone end groups. Biochemical Society Transactions 28, 806–810. Galpaz N, Ronen G, Khalfa Z, Zamir D, Hirschberg J. 2006. A chromoplast-specific carotenoid biosynthesis pathway is revealed by cloning of the tomato white-flower locus. The Plant Cell 18, 1947–1960. Lassmann T, Sonnhammer EL. 2005. Kalign-an accurate and fast multiple sequence alignment algorithm. BMC Bioinformatics 6, 298. Giorio G, Stigliani AL, D’Ambrosio C. 2008. Phytoene synthase genes in tomato (Solanum lycopersicum L.): new data on the structures, the deduced amino acid sequences and the expression patterns. FEBS Journal 275, 527–535. Giuliano G, Bartley GE, Scolnik PA. 1993. Regulation of carotenoid biosynthesis during tomato development. The Plant Cell 5, 379–387. Giuliano G, Tavazza R, Diretto G, Beyer P, Taylor MA. 2008. Metabolic engineering of carotenoid biosynthesis in plants. Trends in Biotechnology 26, 139–145. Ha SH, Kim JB, Park JS, Lee SW, Cho KJ. 2007. A comparison of the carotenoid accumulation in Capsicum varieties that show different ripening colours: deletion of the capsanthin-capsorubin synthase gene is not a prerequisite for the formation of a yellow pepper. Journal of Experimental Botany 58, 3135–3144. Harjes CE, Rocheford TR, Bai L, et al. 2008. Natural genetic variation in lycopene epsilon cyclase tapped for maize biofortification. Science 319, 330–333. Hertz GZ, Stormo GD. 1995. Identification of consensus patterns in unaligned DNA and protein sequences: a large-deviation statistical basis for penalizing gaps. In: Lim HA, Cantor CR eds. Proceedings of the third international conference on bioinformatics and genome research. Singapore: World Scientific Publishing Co., Ltd, 201–216. Lee YS, Kim TH, Kang TW, Chung WH, Shin GS. 2008. WSPMarker: a web tool for calculating selection pressure in proteins and domains using window-sliding. BMC Bioinformatics 12, 9 Suppl 12:S13. Lescot M, Déhais P, Thijs G, Marchal K, Moreau Y, Van de Peer Y, Rouzé P, Rombauts S. 2002. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Research 30, 325–327. Leyser O. 2008. Strigolactones and shoot branching: a new trick for a young dog. Developmental Cell 15, 337–338. Li F, Murillo C, Wurtzel ET. 2007. Maize Y9 is essential for 15-ciszetacarotene isomerization. Plant Physiology 144, 1181–1189. Li F, Vallabhaneni R, Yu J, Rocheford T, Wurtzel ET. 2008a. The maize phytoene synthase gene family: overlapping roles for carotenogenesis in endosperm, photomorphogenesis, and thermal stress tolerance. Plant Physiology 147, 1334–1346. Li F, Vallabhaneni R, Wurtzel ET. 2008b. PSY3, a new member of the phytoene synthase gene family conserved in the Poaceae and regulator of abiotic stress-induced root carotenogenesis. Plant Physiology 146, 1333–1345. Lynch M, Connery J. 2003. The evolutionary demography of duplicate genes. Journal of Structural and Functional Genomics 3, 489–505. 118 | Ahrazem et al. Maere S, De Bodt S, Raes J, Casneuf T, Van Montagu M, Kuiper M, Van de Peer Y. 2005. Modeling gene and genome duplications in eukaryotes. Proceedings of the National Academy of Sciences, USA 102, 5454–5459. Römer S, Hugueney P, Bouvier F, Camara B, Kuntz M. 1993. Expression of the genes encoding the early carotenoid biosynthetic enzymes in Capsicum annuum. Biochemical and Biophysical Research Communications 196, 1414–1421. Marty I, Bureau S, Sarkissian G, Gouble B, Audergon JM, Albagnac G. 2005. Ethylene regulation of carotenoid accumulation and carotenogenic gene expression in colour-contrasted apricot varieties (Prunus armeniaca). Journal of Experimental Botany 417, 1877–1886. Ronen G, Carmel-Goren L, Zamir D, Hirschberg J. 2000. An alternative pathway to beta-carotene formation in plant chromoplasts discovered by map-based cloning of beta and old-gold colour mutations in tomato. Proceedings of the National Academy of Sciences, USA 97, 11102–11107. Misawa N, Shimada H. 1998. Metabolic engineering for the production of carotenoids in non-carotenogenic bacteria and yeasts. Journal of Biotechnology 59, 169–181. Ronen G, Cohen M, Zamir D, Hirschberg J. 1999. Regulation of carotenoid biosynthesis during tomato fruit development: expression of the gene for lycopene epsilon cyclase is down regulated during ripening and is elevated in the mutant delta. The Plant Journal 17, 341–351. Moehs CP, Tian L, Osteryoung KW, DellaPenna D. 2001. Analysis of carotenoid biosynthetic gene expression during marigold petal development. Plant Molecular Biology 45, 281–293. Moller S, Croning MDR, Apweiler R. 2001. Evaluation of methods for the prediction of membrane spanning regions. Bioinformatics 17, 646–653. Moraga AR, Nohales PF, Pérez JA, Gómez-Gómez L. 2004. Glucosylation of the saffron apocarotenoid crocetin by a glucosyltransferase isolated from Crocus sativus stigmas. Planta 219, 955–966. Nakagawa T, Kurose T, Hino T, Tanaka K, Kawamukai M, Niwa Y, Toyooka K, Matsuoka K, Jinbo T, Kimura T. 2007. Development of a series of gateway binary vectors, pGWBs, for realizing efficient construction of fusion genes for plant transformation. Biosciences and Bioengineering 104, 34–41. Osborn TC, Pires JC, Birchler J, et al. 2003. Understanding mechanisms of novel gene expression in polyploids. Trends in Genetics 19, 141–147. Otto SP, Whitton J. 2000. Polyploid incidence and evolution. Annual Review of Genetics 34, 401–437. Park H, Kreunen SS, Cuttriss AJ, DellaPenna D, Pogson BJ. 2002. Identification of the carotenoid isomerase provides insight into carotenoid biosynthesis, prolamellar body formation, and photomorphogenesis. The Plant Cell 14, 321–332. Pecker I, Gabbay R, Cunningham FX, Hirschberg J. 1996. Cloning and characterization of the cDNA for lycopene beta-cyclase from tomato reveals decrease in its expression during fruit ripening. Plant Molecular Biology 30, 807–819. Pogson B, McDonald KA, Truong M, Britton G, DellaPenna D. 1996. Arabidopsis carotenoid mutants demonstrate that lutein is not essential for photosynthesis in higher plants. The Plant Cell 8, 1627–1639. Popovsky S, Paran I. 2000. Molecular genetics of the y locus in pepper: its relation to capsanthin-capsorubin synthase and to fruit colour. Theoretical and Applied Genetics 101, 86–89. Rouseff R, Raley L, Hofsommer HJ. 1996. Application of diode array detection with a C-30 reversed phase column for the separation and identification of saponified orange juice carotenoids. Journal of Agricultural and Food Chemistry 44, 2176–2181. Rubio A, Rambla JL, Ahrazem O, Granell A, Gómez-Gómez L. 2009. Metabolite and target transcript analyses during Crocus sativus stigma development. Phytochemistry 70, 1009–1016. Rubio A, Rambla JL, Santaella M, Gómez MD, Orzaez D, Granell A, Gómez-Gómez L. 2008. Cytosolic and plastoglobuletargeted carotenoid dioxygenases from Crocus sativus are both involved in beta-ionone release. Journal of Biological Chemistry 283, 24816–24825. Steinbrenner J, Linden H. 2001. Regulation of two carotenoid biosynthesis genes coding for phytoene synthase and carotenoid hydroxylase during stress-induced astaxanthin formation in the green alga Haematococcus pluvialis. Plant Physiology 125, 810–817. Tadmor Y, King S, Levi A, Davis A, Meir A, Wasserman B, Hirschberg J, Lewinsohn E. 2005. Comparative fruit colouration in watermelon and tomato. Food Research International 38, 837–841. Thorup TA, Tanyolac B, Livingstone KD, Popovsky S, Paran I, Jahn M. 2000. Candidate gene analysis of organ pigmentation loci in the Solanaceae. Proceedings of the National Academy of Sciences, USA 97, 11192–11197. Verma SK, Bordia A. 1998. Antioxidant property of Saffron in man. Indian Journal of Medical Sciences 52, 205–207. Walsh J. 1995. How often do duplicated genes evolve new functions? Genetics 139, 421–428. Wendel JF. 2000. Genome evolution in polyploids. Plant Molecular Biology 42, 225–249. Wierenga RK, Terpstra P, Hol WGL. 1986. Prediction of the occurrence of the ADP-binding b’b-fold in proteins, using an amino acid sequence fingerprint. Journal of Molecular Biology 187, 101–107. Prince VE, Pickett FB. 2002. Splitting pairs: the diverging fates of duplicated genes. Nature Reviews Genetics 3, 827–837. Wong JC, Lambert RJ, Wurtzel ET, Rocheford TR. 2004. QTL and candidate genes phytoene synthase and zeta-carotene desaturase associated with the accumulation of carotenoids in maize. Theoretical and Applied Genetics 108, 349–359. Rodrigo MJ, Marcos JF, Zacarı́as L. 2004. Biochemical and molecular analysis of carotenoid biosynthesis in flavedo of orange (Citrus sinensis L.) during fruit development and maturation. Journal of Agricultural and Food Chemistry 52, 6724–6731. Wu Y, Zhu Z, Ma L, Chen M. 2008. The preferential retention of starch synthesis genes reveals the impact of whole-genome duplication on grass evolution. Molecular Biology and Evolution 25, 1003–1006. Saffron LYC subfunctionalization | 119 Yu B, Lydiate DJ, Young LW, Schäfer UA, Hannoufa A. 2008. Enhancing the carotenoid content of Brassica napus seeds by downregulating lycopene epsilon cyclase. Transgenic Research 17, 573–585. Zhu C, Yamamura S, Koiwa H, Nishihara M, Sandmann G. 2002. cDNA cloning and expression of carotenogenic genes during flower development in Gentiana lutea. Plant Molecular Biology 48, 277–285. Zhu C, Yamamura S, Nishihara M, Koiwa H, Sandmann G. 2003. cDNAs for the synthesis of cyclic carotenoids in petals of Gentiana lutea and their regulation during flower development. Biochimica et Biophysica Acta 1625, 305–308.