Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and education use, including for instruction at the authors institution and sharing with colleagues. Other uses, including reproduction and distribution, or selling or licensing copies, or posting to personal, institutional or third party websites are prohibited. In most cases authors are permitted to post their version of the article (e.g. in Word or Tex form) to their personal website or institutional repository. Authors requiring further information regarding Elsevier’s archiving and manuscript policies are encouraged to visit: http://www.elsevier.com/authorsrights Author's personal copy Experimental Eye Research 110 (2013) 70e75 Contents lists available at SciVerse ScienceDirect Experimental Eye Research journal homepage: www.elsevier.com/locate/yexer Overexpression of peroxiredoxin 2 in pterygium. A proteomic approach V.M. Bautista-de Lucio a, *, N.L. López-Espinosa a, A. Robles-Contreras b, H.J. Pérez-Cano a, H. Mejía-López a, G. Mendoza d, M.C. Jiménez-Martínez b, d, Y. Garfias c, d a Microbiology and Ocular Proteomics, Research Unit, Institute of Ophthalmology Fundación de Asistencia Privada Conde de Valenciana, Chimalpopoca, 14 Colonia Obrera, 06800 México City, Mexico b Immunology Dept, Institute of Ophthalmology Fundación de Asistencia Privada Conde de Valenciana, Chimalpopoca, 14 Colonia Obrera, 06800 México City, Mexico c Cellular Biology, Research Unit, Institute of Ophthalmology Fundación de Asistencia Privada Conde de Valenciana, Chimalpopoca, 14 Colonia Obrera, 06800 México City, Mexico d Department of Biochemistry, Faculty of Medicine, UNAM, Insurgentes Sur 3000, Coyoacán, 04510 Mexico City, Mexico a r t i c l e i n f o a b s t r a c t Article history: Received 1 November 2012 Accepted in revised form 1 March 2013 Available online 13 March 2013 Pterygium is one of the most frequent pathologies in ophthalmology, and is a benign, fibrovascular lesion originating from the bulbar conjunctiva. It is composed of an epithelium and highly vascular, subepithelial, loose connective tissue. The etiology of pterygium is not clearly understood; the most widely recognized originating factor is ultraviolet radiation. It has been proposed that pterygium and neoplasia have common features, raising the possibility that pterygium is a neoplastic-like growth disorder. In this study, proteomic analysis was performed to show that peroxiredoxin 2 is overexpressed in pterygia compared to healthy conjunctivas. Twelve pterygium specimens were obtained together with healthy conjunctival tissue from the same eyes. Total proteins of pterygia and healthy conjunctivas were analyzed in SDS-PAGE. This analysis showed protein bands expressed exclusively in pterygium samples at the range of 20e25 kDa. After this, 2D electrophoresis was performed for the separation of total proteins; differential spots expressed in pterygium were excised and sequenced. Mass spectrometry (MS) data were searched in the NCBInr and EST databases using the MASCOT program. The spot was identified as peroxiredoxin 2. Real-time PCR, western blot and immunohistochemistry showed that peroxiredoxin 2 was increased in pterygium compared to healthy conjunctiva. Although, these results suggest that overexpression of peroxiredoxin 2 in pterygium could protect the cell against oxidative stresseinduced apoptosis, further studies are required to establish the functional role of peroxiredoxin 2 in pterygium to determine its role in peroxidation and apoptosis in this pathology. Ó 2013 Elsevier Ltd. All rights reserved. Keywords: peroxiredoxin 2 pterygium oxidative stress 1. Introduction Pterygium is an overgrowth of fibrovascular tissue, with a winglike appearance, from the conjunctiva over the cornea (Chui et al., 2008; Solomon et al., 2003; Taylor et al., 1992; Wong et al., 2001). Pterygium pathophysiology is characterized by invasion of the basement membrane of normal cornea with the concomitant dissolution of Bowman’s layer (Dushku and Reid, 1994). Although the pathogenesis of pterygium is not clearly understood, certain findings concerning common features in pterygium and neoplasia have been proposed, raising the possibility that a pterygium is a neoplastic-like growth disorder (Coroneo, 1993). Although several theories have been postulated for the pathogenesis of pterygium, including immunological mechanisms, * Corresponding author. Tel.: þ52 55 54421700x3212; fax: þ52 55 54421700x3206. E-mail address: vbautistal@institutodeoftalmologia.org (V.M. Bautista-de Lucio). 0014-4835/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.exer.2013.03.001 infections, and ultraviolet exposition (Gallagher et al., 2001; Garfias et al., 2009; Nolan et al., 2003), the precise basis by which pterygium is caused remains still under study. In this context, ultraviolet exposition acts directly by phototoxic or indirectly generating reactive oxygen species (ROS)(Balci et al., 2011). It has been documented that ROS and metabolic activation are able to modulate gene expression, and are relevant in oxidative stress in tumor formation (Armstrong et al., 2002; Martini and Ursini, 1996; Okada, 2007). Moreover, it has been described that ROS activity induced the formation of 8-hydroxydeoxyguanosine, which is a ubiquitous marker for oxidative stress; interestingly, this molecule is highly expressed in pterygium samples, suggesting an oxidative stress environment, which may be favoring the development of this pathology (Kau et al., 2006; Perra et al., 2006; Tsai et al., 2005). Likewise, ROS are responsible for inducing cyclooxygenase-2 expression, which has been found expressed in pterygium (Maxia et al., 2009). Additionally, the increase in nitric oxide and malone dialdehyde molecules found in pterygium samples, highlights the Author's personal copy V.M. Bautista-de Lucio et al. / Experimental Eye Research 110 (2013) 70e75 role of the oxidative enzymatic function imbalance described in pterygia (Balci et al., 2011). In an attempt to identify enzymes responsible to detoxify free radicals from the environment, Balci et al. (2011) has reported a reduced activity of superoxide dismutase and glutathione peroxidase which results in an increase levels of oxidative stress molecules. In the same way, it has been reported that the deficiency of glucose-6-phosphate-dehydrogenase is considered a risk factor for the development of pterygium (Peiretti et al., 2010). Peroxiredoxin 2 is a cytoplasmic enzyme that reduces the intracellular ROS levels such as peroxide and hydroperoxide that protects the cell from oxidative stress in several biological processes and detoxification of oxidants (Fujii and Ikeda, 2002). It has been described that peroxiredoxin 2 overexpression protects significantly from peroxide induced apoptosis and necrosis, while down-regulation of this enzyme promotes injurious effects of oxidative stress in cardiomyocytes (Venardos et al., 2007). Recently, Liang et al. (2011) reported that pterygium expresses high levels of cellular proliferation proteins and low levels of cellular apoptosis markers, suggesting that there is a disruption in the equilibrium among proliferation and apoptosis, favoring cell proliferation in pterygium. In this study, proteomic analysis was performed to show that peroxiredoxin 2 is overexpressed in pterygia compared to healthy conjunctivas. 2. Material and methods 2.1. Biological samples The institutional ethics board approved this study. Twelve pterygium samples were obtained from 12 patients, 6 males and 6 females, with mean age 41 3 year old. Samples of healthy conjunctiva were obtained from the same patients who underwent pterygium surgical excision. The specimens of the healthy conjunctivas were taken from the autografts obtained from the superior bulbar conjunctiva. All the patients were signed informed consent to participate in the study. 2.2. Extraction and quantification of tissue proteins Specimens were located in ice-cold lysis buffer [20 mM Tris pH 7.5; 1 mM EDTA; 0.15 M NaCl; 50 mM NaF; 1% Triton X-100; 4 mM Na3VO4 and protease inhibitor cocktail tablets (Roche, Mannheim, Germany)] immediately after surgical excision; the tissues were homogenized using Tissue-Ruptor (Qiagen, Hilden, Germany), according to the manufacturer’s instructions. Proteins were quantified by the DC Protein Assay kit (Biorad, California, USA). Eighty micrograms of protein per sample were cleaned using the Ready Prep TM 2-D Cleanup kit (Biorad, California, USA) and were kept at 80 C until use. 2.3. Isoelectro focusing (IEF) and 2-D gel electrophoresis The protein samples were further diluted with an equal volume of the 2 rehydration buffer (8 M urea, 2% w/v CHAPS, 10 mM DTT, 0.2% Bio-Lyte). The first dimension electrophoresis was carried out on a Protein IEF Cell (Biorad, California, USA) using pH3-10 Immobilized pH Gradient (IPG) gel strips of 11 cm length. The IEF was performed at 20 C under the following conditions: 10 h at 50 V; 1 h at 100 V; 2 h at 4000 V and held at 4000 V until the total Vhr reached 20,000 Vhr. After isoelectro focusing, the IPG strips were reduced for 10 min in an equilibration buffer I (375 mM TrisHCl, pH 8.8, 6 M urea, 2% DTT), and subsequently alkylated for 10 min in an equilibration buffer II (375 mM Tris-HCl, pH 8.8, 6 M 71 urea, 2% SDS, 2% iodoacetamide). The second dimensional separation was carried out on a custom-made 12% SDS-PAGE and a Miniprotean electrophoresis system (BioRad, California, USA). Gels were stained with Coomassie blue and the images were digitalized using G-Box System and Gene Snap Software version 7.12.06 (Syngene, London, UK). Protein spots were excised from SDS-PAGE with a sterile scalpel. The gel pieces were washed with 50% (v/v) acetonitrile in 25 mM ammonium bicarbonate (pH 8.5) for 15 min twice to remove Coomassie dye. After dehydration with 100% (v/v) acetonitrile for 10 min at room temperature (24 3 C, the gel pieces were vacuum-dried and rehydrated with sequencing-grade modified trypsin (Promega, Madison, WI.) in 25 mM ammonium bicarbonate (pH 8.5) at 37 C overnight. The in-gel tryptic digested samples were injected into an integrated nano-LC-ESI-MS/MS system (quadrupole/time of flight, Ultima API, Micromass, Manchester, UK). The injected samples were first trapped and desalted isocratically on an LC-Packing PepMap C18 m-pre-column cartridge (Dionex, Sunnyvale, CA, USA). After dissolving with 0.1% formic acid, the samples were loaded into an analytical C18 capillary column connected online to the mass spectrometer. Instrumental operation, data acquisition, and analysis were performed under the full control of Mass-Lynx 4.0 (Micromass). The 1-s survey scans were run over the mass range of m/z 400 to 2000. A maximum of three concurrent MS/MS acquisitions were triggered for 2þ, 3þ, and 4þ charged precursor detection at an intensity above the predefined threshold. The acquired peptide ions were analyzed with the Mascot program (www.matrixscience.com) using both NCBInr and EST databases. Parameters for the Mascot search were peptide mass tolerance of 1 Da; MS/MS ion mass tolerance of 1 Da, maximally one missed cleavage; and tryptic digestion. Variable modifications included methionine oxidation and cysteine carbamidomethylation. Only proteins with significant ions scores (>46) were reported. 2.4. Real time reverse transcription PCR analysis Samples collected were snap frozen and kept at 80 C until processed. Isolation of total RNA from biological specimens was performed using the RNeasy kit (Qiagen, Hilden, Germany). Two micrograms of RNA was reverse-transcripted using Oligo-dT (Promega, Madison WI, USA) at 42 C for 30 min and the reaction was stopped at 95 C for 5 min. From the obtained cDNA, real time PCR was performed using the 18s gene as previously described (Steinau et al., 2006). Up to 100 ng of starting RNA was used for amplification in a Rotor-Gene 6000 apparatus (Corbett Life Science, Sidney, Australia). Primers for 18s and PRDX2 amplification had the same melting temperature (60 C) and were 18S forward 50 TCG ATGCTCTTAGCTGAGTGTCC -30 , 18s reverse 50 - TGATCGTCTTC GAACCTCCG e 30 ; PRXD2 forward 50 -CCAGACGCTTGTCTGAGGAT-30 , PRXD2 reverse 50 -ACGTTGGGCTTAATCGTGTC-30 . To identify that the amplification reactions did not form any spurious sub-products, the temperature gradient was performed from 72 C to 95 C and was analyzed by melt curve. In all cases, only one curve was obtained for each amplification reaction. Relative amplification increment was calculated using the formula 2-DDCT (Livak and Schmittgen, 2001) and 18s gene was used as the housekeeping gene. Each experiment was performed by triplicate in three independent assays. 2.5. Western blot analysis Sixty micrograms of proteins obtained from pterygia and healthy conjunctivas were loaded onto 12% SDS-PAGE. After electrophoresis, the proteins were then transferred to a nitrocellulose Author's personal copy 72 V.M. Bautista-de Lucio et al. / Experimental Eye Research 110 (2013) 70e75 Fig. 1. Differential protein expression in pterygium and healthy conjunctiva by 2D-electrophoresis. Proteins were solved by isoelectric point (bottom arrows) and molecular weight in a 12% SDS-PAGE and stained with Coomassie blue. In the area corresponding to 20e25 kDa, a spot was weakly expressed in healthy conjunctiva (arrow left panel); in contrast, the expression of the spot located at the same area was stronger expressed in pterygium compared to healthy conjunctiva (arrow right panel). Molecular weight markers are shown in the left side of the figure. membrane (BioRad, California, USA); nonspecific binding was blocked incubating for 1 h at room temperature with 5% nonfat milk diluted in PBS-Tween 20 (0.1%). Membranes were incubated overnight at 4 C with mouse polyclonal anti-peroxiredoxin 2 diluted 1:3000 (R&D Systems, Minneapolis, MN) or rabbit polyclonal anti-GAPDH diluted 1:200 (SantaCruz, CA USA). Secondary biotinylated antibodies anti-mouse and anti-rabbit were diluted 1:20000 (Jackson ImmunoResearch West Grove, PA, USA). Finally, the membranes were incubated with peroxidase conjugated antibiotin (Roche, IN, USA) antibodies diluted 1:5000, for 1 h at RT. Enhanced chemiluminescence reagent (GE, Piscataway, NJ, USA) was used to develop the reaction. Chemiluminescence was visualized and digitalized with G-Box Dyversity System (Syngene, London, UK) and analyzed with GeneTools software version 4.03.00 (Syngene, London, UK). 2.6. Immunohistochemistry Tissue segments were fixed by 10% formalin overnight and processed for paraffin embedding. Sections of 5 mm were cut, mounted on glass poly-lysine charged slides. All slides were then deparaffinized and re-hydrated with a gradient of ethanol concentrations. Antigen retrieval was performed heating the samples in 10 mmol/L citrate buffer (pH 6.0). Samples were then washed with 0.1%Tween-PBS (pH 7.3); this buffer was used for all subsequent washes. Mouse anti-human peroxiredoxin-2 was used as primary antibody (R&D Systems), using 1:200 dilution this antibody was incubated at room temperature (RT) for 30 min. Samples were washed twice. All samples were incubated 30 min with universal biotinylated secondary antibodies at RT. The samples were then washed twice and a final incubation of 30 min at RT was Fig. 2. Protein identification by MS. a) Biochemical characteristic of PRDX 2 obtained from MS analysis. After enzyme digestion, protein identification with high score (445) shows that the spot mentioned above corresponds to peroxiredoxin 2; code is the access number of sequence molecule, the protein was compared to NCBInr and EST databases. Schematic representation of the matched peptides in a reference sequence shows 38% of protein coverage (b). It is shown the expected and observed MW, ion score and p-value/expect for each peptide (c). Author's personal copy V.M. Bautista-de Lucio et al. / Experimental Eye Research 110 (2013) 70e75 73 performed using streptavidin-peroxidase. Signals were developed using 3, 30 -diaminobenzidine for 5 min and counterstained with Mayer’s hematoxylin (Dako, Glostrup, Denmark). Negative controls were prepared by leaving out the primary antibody. Breast cancer was used as positive controls for peroxiredoxin 2 (Noh et al., 2001). 3. Results 3.1. Two-dimensional gel electrophoresis profile The proteomic profile from healthy conjunctivas compared to proteomic profile from pterygia was different. When proteins were resolved by SDS-PAGE electrophoresis on 12% gel there was an evident difference in the identification of a band with a molecular weight of around 20 kDa presented only in pterygia samples, meanwhile, this band was totally absent in proteins from healthy conjunctivas (data not shown). This remarkable result guided us to analyze putative protein differences in a 2D gel electrophoresis around the 20 kDa area. When 2D gel analysis was performed, interestingly there was a spot only present in pterygium samples, in contrast to healthy conjunctivas in which this spot was absent (Fig. 1). 3.2. Protein identification by MS Mass spectrometry analysis from the spot mentioned above was performed, in order to identify the protein(s) into the spot differentially expressed in pterygia compared to healthy conjunctivas. The results of MS are summarized in Fig. 2. As mentioned in the Fig. 2 the spot identified by MS matched to peroxiredoxin 2 protein. 3.3. Validation of overexpression of peroxiredoxin 2 by real time PCR and western blot Real time RT-PCR was performed to corroborate the differences described in the proteomic profile and analyzed by MS, of both samples from pterygia and healthy conjunctivas. There was 4 times fold increase on the expression of peroxiredoxin 2 in pterygia samples compared to healthy conjunctivas according to the method suggested by Livak and Schmittgen (2001), as shown in Fig. 3a. Levels of peroxiredoxin 2 protein, were analyzed by western blot, results showed that peroxiredoxin 2 had higher expression in pterygia in contrast to healthy conjunctivas (Fig. 3b). 3.4. Peroxiredoxin 2 is exclusively expressed in pterygium tissue To show the presence and tissue localization of peroxiredoxin 2, immunohistochemistry assays were performed in pterygium biopsies and healthy conjunctivas. As shown in Fig. 4, peroxiredoxin 2 was exclusively expressed in pterygium. Interestingly, this protein was preferentially localized in pterygium basal epithelium. Unlike pterygium biopsies, peroxiredoxin 2 was absent in healthy conjunctiva specimens. 4. Discussion Proteomics has expanded the opportunities to discover diseasespecific proteins involved in many diseases, including those from the ophthalmic field such as keratoconus (Joseph et al., 2011), glaucoma (Sacca et al., 2012) and myopia (Frost and Norton, 2012). The proteomic technique includes two-dimensional electrophoresis (2-D) and mass spectrometry; the former studies proteins separated by their isoelectric point and their molecular sizes; meanwhile, mass spectrometry characterizes and identifies peptides, amino acid sequences using bioinformatics tools (Lemeer Fig. 3. Validation of overexpression of peroxiredoxin 2 by real time PCR and western blot. Peroxiredoxin 2 was overexpressed in pterygium in comparison to healthy conjunctiva. a) Real time RT-PCR showed that there was an overexpression of the peroxiredoxin 2 transcript in pterygia compared to healthy conjunctivas. b) Western blot was performed to corroborate the overexpression of peroxiredoxin 2 protein; as shown in the figure there is a weak band in healthy conjunctivas; compared to a stronger band found in pterygia, corresponding to peroxiredoxin 2 protein. GAPDH protein was used as a loading control. This figure is a representative assay from four western blots. et al., 2012). In this study, a proteomics approach was performed to identify putative differences in pterygium samples compared to healthy conjunctivas. Interestingly, a spot identified as peroxiredoxin 2 was overexpressed in pterygia in comparison to healthy conjunctivas. Similarly, proline-rich protein 5 has been found in tear samples of pterygium patients, using proteomics method (Zhou et al., 2006), sustaining the value of this technique to study pterygium pathology. As it has been shown, proteomics is a versatile tool to study this pathology, since proteomics is able to identify differences in tear samples, as well as in biopsies specimens. So far we know, this is the first study comparing samples from pterygia and healthy conjunctivas by 2D-MS assays, which opens a new filed in the study of pterygium. In order to validate the overexpression of peroxiredoxin 2, RT-PCR, western blot and immunohistochemistry assays were performed. The results of the present study indicate that both transcript and protein levels from peroxiredoxin 2 were increased in pterygium samples compared to healthy conjunctivas. These results suggest that there is a direct relationship between transcript and translation of this oxidative enzyme. The positive regulation of the expression of peroxiredoxin 2 might be associated to the increase of ROS found in pterygium samples observed by other authors (Balci et al., 2011). Ultraviolet (UV) radiation damage, irritation or inflammation have been proposed as possible etiopathological factors for pterygium development (Mackenzie et al., 1992; Saw and Tan, 1999). The mechanism by which UV radiation induces uncontrolled proliferation in cells from pterygium remains unclear. The effects of UV radiation are driven either directly by the UV phototoxic effect or indirectly by Author's personal copy 74 V.M. Bautista-de Lucio et al. / Experimental Eye Research 110 (2013) 70e75 Fig. 4. Expression and localization of peroxiredoxin 2 in pterygium. Immunohistochemistry assays performed in pterygium and healthy conjunctiva, showed the presence of peroxiredoxin 2 protein preferentially in pterygia basal epithelium, meanwhile there was no immunostaining of this protein in healthy conjunctivas. A cytoplasmic and granular pattern was observed in pterygium positive cells. Breast cancer biopsies were used as positive controls for peroxiredoxin 2 immunostaining. From left to right 100, 400, 1000. the formation of ROS. Presence of ROS regulates the expression of several proteins involved in ROS metabolism; it has been demonstrated that 8-hydroxydeoxyguanosine, cyclooxigenase 2 and survivin are overexpressed in pterygium, and proteins such as superoxide dismutase and glutathione peroxidase showed reduced activity, all these data suggest that all these proteins are involved in the development of this cell surface pathology (Shoham et al., 2008). Peroxiredoxin 2 is a member of an antioxidant enzyme family, which has the ability to reduce H2O2 and hydroperoxides into water and alcohol, respectively. Peroxiredoxin 2 is a 25 kDa protein, and it has been found to be abundant in the cytosol from a wide range of tissues, making it a major regulator of the H2O2 signal in the cell. It has been demonstrated that overexpression of this enzyme protects leukemia cells from apoptosis (Zhang et al., 1997), meanwhile, blocking peroxiredoxin 2 expression, enhanced radiation-induced cancer cell death (Park et al., 2000). These data support the proposal that peroxiredoxin 2 could be involved in the inhibition of pterygium cell apoptosis. As it has been described in cardiomyocytes, the overexpression of peroxiredoxin 2 protected from cell apoptosis, by increasing Bcl2 and decreasing Bax protein expression, and diminishing caspase-3, -9 and -12 activity (Zhao et al., 2009). Whether peroxiredoxin 2 is playing a similar role in pterygium as in cardiomyocytes is still unclear. Many isoforms from peroxiredoxin family have been implicated in survival from several ocular cells, including retinal cells, trabecular meshwork cells and epithelial cells from the lens (Fatma et al., 2009, 2011; Tulsawani et al., 2010); these findings strengthen the possible contribution of peroxiredoxin 2 in cell survival described in pterygium cells (Kase et al., 2007). Although we have shown that peroxiredoxin 2 was preferentially localized in pterygium basal epithelium, other authors have demonstrated that apoptotic cells are found mainly confined to basal epithelial cells in pterygia (Liang et al., 2011; Tan et al., 2000), leading the chance that peroxiredoxin 2 is not the only oxidative enzyme involved in the inhibition of apoptosis in pterygium. Further studies are required to establish the functional role of peroxiredoxin 2 in pterygium to determine its role in peroxidation and apoptosis in this pathology. Acknowledgments This work was partially supported by the Conde de Valenciana Foundation. The authors wish to thank Verónica Romero for her technical assistance. This work is dedicated in loving memory of Guillermo Mendoza-Hernández. References Armstrong, J.S., Steinauer, K.K., Hornung, B., Irish, J.M., Lecane, P., Birrell, G.W., Peehl, D.M., Knox, S.J., 2002. Role of glutathione depletion and reactive oxygen species generation in apoptotic signaling in a human B lymphoma cell line. Cell Death Differ. 9, 252e263. Balci, M., Sahin, S., Mutlu, F.M., Yagci, R., Karanci, P., Yildiz, M., 2011. Investigation of oxidative stress in pterygium tissue. Mol. Vis. 17, 443e447. Chui, J., Di Girolamo, N., Wakefield, D., Coroneo, M.T., 2008. The pathogenesis of pterygium: current concepts and their therapeutic implications. Ocul. Surf. 6, 24e43. Coroneo, M.T., 1993. Pterygium as an early indicator of ultraviolet insolation: a hypothesis. Br. J. Ophthalmol. 77, 734e739. Dushku, N., Reid, T.W., 1994. Immunohistochemical evidence that human pterygia originate from an invasion of vimentin-expressing altered limbal epithelial basal cells. Curr. Eye Res. 13, 473e481. Fatma, N., Kubo, E., Toris, C.B., Stamer, W.D., Camras, C.B., Singh, D.P., 2009. PRDX6 attenuates oxidative stress- and TGFbeta-induced abnormalities of human trabecular meshwork cells. Free Radic. Res. 43, 783e795. Fatma, N., Singh, P., Chhunchha, B., Kubo, E., Shinohara, T., Bhargavan, B., Singh, D.P., 2011. Deficiency of Prdx6 in lens epithelial cells induces ER stress responsemediated impaired homeostasis and apoptosis. Am. J. Physiol. Cell Physiol. 301, C954eC967. Frost, M.R., Norton, T.T., 2012. Alterations in protein expression in tree shrew sclera during development of lens-induced myopia and recovery. Invest. Ophthalmol. Vis. Sci. 53, 322e336. Fujii, J., Ikeda, Y., 2002. Advances in our understanding of peroxiredoxin, a multifunctional, mammalian redox protein. Redox Rep. 7, 123e130. Author's personal copy V.M. Bautista-de Lucio et al. / Experimental Eye Research 110 (2013) 70e75 Gallagher, M.J., Giannoudis, A., Herrington, C.S., Hiscott, P., 2001. Human papillomavirus in pterygium. Br. J. Ophthalmol. 85, 782e784. Garfias, Y., Bautista-De Lucio, V.M., Garcia, C., Nava, A., Villalvazo, L., JimenezMartinez, M.C., 2009. Study of the expression of CD30 in pterygia compared to healthy conjunctivas. Mol. Vis. 15, 2068e2073. Joseph, R., Srivastava, O.P., Pfister, R.R., 2011. Differential epithelial and stromal protein profiles in keratoconus and normal human corneas. Exp. Eye Res. 92, 282e298. Kase, S., Takahashi, S., Sato, I., Nakanishi, K., Yoshida, K., Ohno, S., 2007. Expression of p27(KIP1) and cyclin D1, and cell proliferation in human pterygium. Br. J. Ophthalmol. 91, 958e961. Kau, H.C., Tsai, C.C., Lee, C.F., Kao, S.C., Hsu, W.M., Liu, J.H., Wei, Y.H., 2006. Increased oxidative DNA damage, 8-hydroxydeoxy- guanosine, in human pterygium. Eye (Lond) 20, 826e831. Lemeer, S., Hahne, H., Pachl, F., Kuster, B., 2012. Software tools for MS-based quantitative proteomics: a brief overview. Methods Mol. Biol. 893, 489e499. Liang, K., Jiang, Z., Ding, B.Q., Cheng, P., Huang, D.K., Tao, L.M., 2011. Expression of cell proliferation and apoptosis biomarkers in pterygia and normal conjunctiva. Mol. Vis. 17, 1687e1693. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402e408. Mackenzie, F.D., Hirst, L.W., Battistutta, D., Green, A., 1992. Risk analysis in the development of pterygia. Ophthalmology 99, 1056e1061. Martini, G., Ursini, M.V., 1996. A new lease of life for an old enzyme. Bioessays 18, 631e637. Maxia, C., Perra, M.T., Demurtas, P., Minerba, L., Murtas, D., Piras, F., Cabrera, R., Ribatti, D., Sirigu, P., 2009. Relationship between the expression of cyclooxygenase-2 and survivin in primary pterygium. Mol. Vis. 15, 458e463. Noh, D.Y., Ahn, S.J., Lee, R.A., Kim, S.W., Park, I.A., Chae, H.Z., 2001. Overexpression of peroxiredoxin in human breast cancer. Anticancer Res. 21, 2085e2090. Nolan, T.M., DiGirolamo, N., Sachdev, N.H., Hampartzoumian, T., Coroneo, M.T., Wakefield, D., 2003. The role of ultraviolet irradiation and heparin-binding epidermal growth factor-like growth factor in the pathogenesis of pterygium. Am. J. Pathol. 162, 567e574. Okada, F., 2007. Beyond foreign-body-induced carcinogenesis: impact of reactive oxygen species derived from inflammatory cells in tumorigenic conversion and tumor progression. Int. J. Cancer 121, 2364e2372. Park, S.H., Chung, Y.M., Lee, Y.S., Kim, H.J., Kim, J.S., Chae, H.Z., Yoo, Y.D., 2000. Antisense of human peroxiredoxin II enhances radiation-induced cell death. Clin. Cancer Res. 6, 4915e4920. Peiretti, E., Mandas, A., Cocco, P., Norfo, C., Abete, C., Angius, F., Pani, A., Vascellari, S., Del Fiacco, G., Cannas, D., Diaz, G., Dessi, S., Fossarello, M., 2010. Glucose-6- 75 phosphate-dehydrogenase deficiency as a risk factor for pterygium. Invest. Ophthalmol. Vis. Sci. 51, 2928e2935. Perra, M.T., Maxia, C., Corbu, A., Minerba, L., Demurtas, P., Colombari, R., Murtas, D., Bravo, S., Piras, F., Sirigu, P., 2006. Oxidative stress in pterygium: relationship between p53 and 8-hydroxydeoxyguanosine. Mol. Vis. 12, 1136e1142. Sacca, S.C., Centofanti, M., Izzotti, A., 2012. New proteins as vascular biomarkers in primary open angle glaucomatous aqueous humor. Invest. Ophthalmol. Vis. Sci. 53, 4242e4253. Saw, S.M., Tan, D., 1999. Pterygium: prevalence, demography and risk factors. Ophthalmic Epidemiol. 6, 219e228. Shoham, A., Hadziahmetovic, M., Dunaief, J.L., Mydlarski, M.B., Schipper, H.M., 2008. Oxidative stress in diseases of the human cornea. Free Radic. Biol. Med. 45, 1047e1055. Solomon, A., Grueterich, M., Li, D.Q., Meller, D., Lee, S.B., Tseng, S.C., 2003. Overexpression of Insulin-like growth factor-binding protein-2 in pterygium body fibroblasts. Invest. Ophthalmol. Vis. Sci. 44, 573e580. Steinau, M., Rajeevan, M.S., Unger, E.R., 2006. DNA and RNA references for qRT-PCR assays in exfoliated cervical cells. J. Mol. Diagn. 8, 113e118. Tan, D.T., Tang, W.Y., Liu, Y.P., Goh, H.S., Smith, D.R., 2000. Apoptosis and apoptosis related gene expression in normal conjunctiva and pterygium. Br. J. Ophthalmol. 84, 212e216. Taylor, H.R., West, S., Munoz, B., Rosenthal, F.S., Bressler, S.B., Bressler, N.M., 1992. The long-term effects of visible light on the eye. Arch. Ophthalmol. 110, 99e104. Tsai, Y.Y., Cheng, Y.W., Lee, H., Tsai, F.J., Tseng, S.H., Lin, C.L., Chang, K.C., 2005. Oxidative DNA damage in pterygium. Mol. Vis. 11, 71e75. Tulsawani, R., Kelly, L.S., Fatma, N., Chhunchha, B., Kubo, E., Kumar, A., Singh, D.P., 2010. Neuroprotective effect of peroxiredoxin 6 against hypoxia-induced retinal ganglion cell damage. BMC Neurosci. 11, 125. Venardos, K.M., Perkins, A., Headrick, J., Kaye, D.M., 2007. Myocardial ischemiareperfusion injury, antioxidant enzyme systems, and selenium: a review. Curr. Med. Chem. 14, 1539e1549. Wong, T.Y., Foster, P.J., Johnson, G.J., Seah, S.K., Tan, D.T., 2001. The prevalence and risk factors for pterygium in an adult Chinese population in Singapore: the Tanjong Pagar survey. Am. J. Ophthalmol. 131, 176e183. Zhang, P., Liu, B., Kang, S.W., Seo, M.S., Rhee, S.G., Obeid, L.M., 1997. Thioredoxin peroxidase is a novel inhibitor of apoptosis with a mechanism distinct from that of Bcl-2. J. Biol. Chem. 272, 30615e30618. Zhao, W., Fan, G.C., Zhang, Z.G., Bandyopadhyay, A., Zhou, X., Kranias, E.G., 2009. Protection of peroxiredoxin II on oxidative stress-induced cardiomyocyte death and apoptosis. Basic Res. Cardiol. 104, 377e389. Zhou, L., Beuerman, R.W., Foo, Y., Liu, S., Ang, L.P., Tan, D.T., 2006. Characterisation of human tear proteins using high-resolution mass spectrometry. Ann. Acad. Med. Singap. 35, 400e407.