* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Molecular Cloning and Nucleotide Sequence of the 3
Multilocus sequence typing wikipedia , lookup
Gene therapy of the human retina wikipedia , lookup
Copy-number variation wikipedia , lookup
Expression vector wikipedia , lookup
Transposable element wikipedia , lookup
Genetic engineering wikipedia , lookup
Biochemistry wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
Molecular cloning wikipedia , lookup
Molecular ecology wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Restriction enzyme wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Gene therapy wikipedia , lookup
Non-coding DNA wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Genomic library wikipedia , lookup
Gene nomenclature wikipedia , lookup
Gene expression wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Gene desert wikipedia , lookup
Gene regulatory network wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Biosynthesis wikipedia , lookup
Genetic code wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Point mutation wikipedia , lookup
Journal of General Microbiology (1 987), 133, 1089-1 097. Printed in Great Britain 1089 Molecular Cloning and Nucleotide Sequence of the 3-Isopropylmalate Dehydrogenase Gene of Cmdida utilis By K A Z U H I R O HAMASAWA, Y U K U H A R U KOBAYASHI, S H I G E Y O S H I H A R A D A , K O J I YODA, M A K A R I Y A M A S A K I * A N D G A K U Z O T A M U R A Department of Agricultural Chemistry, The University of Tokyo, Bunkyo-ku, Tokyo 113, Japan (Received 2 July 1986; revised 27 October 1986) A 34sopropylmalate dehydrogenase (3-IMDH, EC 1.1 . 1 .85) gene was cloned from a gene library of Candida utilis. One of the plasmids, pYKL30, could complement Escherichiu coli leuB and Saccharomyces cerevisiae leu2 auxotrophs; a 2.2 kb Hind111 fragment subcloned in pBR322 could still complement the IeuB mutation. Southern hybridization confirmed that this fragment was derived from C. utilis. An open reading frame of 1089 bp that corresponded to a polypeptide of 363 amino acids, one residue shorter than the 3-IMDH of S . cerevisiae, was found in the cloned fragment. The homology between the 3-IMDHs of C. utilis and S . cerevisiae was 76.2% in nucleotides and 85.4% in amino acids. In contrast, the homology between the 3-IMDHs of C. utilis and Thermus thermophiluswas much smaller and was restricted to some regions of the gene. INTRODUCTION Cell mass of strains of Candida utilis has been recognized to be useful as a food resource since the early studies of Fink et al. (1936) on the fermentative nature of the strains. As C.utilis generally requires no growth factors such as vitamins and has a high growth rate, it has been cultured on a large scale with sulphite waste liquor containing hemicellulose as the major carbon source. Culture broth of some strains of C. utilis contains many medically useful materials such as RNA, glutathione, NAD and coenzyme A. Although C. utilis is highly useful in the fermentation industry, there is little genetic information on this organism mainly because of the difficulty in obtaining auxotrophic mutants. In this report, a gene coding for 3-isopropylmalate dehydrogenase (3-IMDH, EC 1.1 . 1 .85) was cloned from a strain of C. utilis and examined in detail. This gene is homologous to LEU2 of Saccharomyces cerevisiae, which is frequently used in genetic studies. It should be of help to construct Leu- mutants, by gene disruption, to be used as recipient strains with a selectable marker in cloning based on C. utilis. METHODS Strains, media and reagents. Candida utilis ATCC 9226 (a food yeast) obtained from the American Type Culture Collection, Saccharomyces cerevisiae AH22 (MATa leu2-3 leu2-112 his3-1 canl-100)obtained from Y. Fukuda, the Mitsubishi-Kasei Institute of Life Science, and Escherichia coli K12 RRI (F- leuB6 proA2 thi-1 arall) obtained from J. Lederberg, University of Stanford, were used in this study. The general growth medium was YPD medium (yeast extract, 1 %, w/v, peptone, 2%, w/v, glucose, 2%, w/v) for yeasts or nutrient broth (peptone, 1 %, w/v, meat extract, 0.3%, NaCI, 0.5%) for bacteria. Bacterial transformants were selected on broth agar plates containing ampicillin (100 pg ml-*). Complementation tests were done on synthetic medium (Davis, 1948)for bacteria or on Difco nitrogen base medium for yeast. Restriction enzymes were products of Takara Brewery Co. (Japan) or Boehringer Mannheim (West Germany). Cloning of Sau3AI fragments from C . utilis chromosomal DNA. Chromosomal DNA (50pg) of C . utilis was partially digested with Sau3A 1. The digested DNA was electrophoresed in a low-melting-temperature agarose gel, Abbreciations: 3-IMDH, 3-isopropylmalate dehydrogenase; ORF, open reading frame. 0001-3565 0 1987 SGM Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Wed, 14 Jun 2017 21:49:39 1090 K . HAMASAWA A N D OTHERS C EIH [[ c,I J BamH I Pv (6 9 kb) a, P 4 T4 ligase s EH Hind[[] Hind111 2.5 kb fragment C T4 ligase E E Suu3A I partial digest ".) LJj pYKL45 EIH Bg A, I /BamH I c Pv // pYKL40 r v EcoRI partial digest T4 ligase Suu3A I! Fig. 1. Construction and restriction maps of subclones. Partial digests of the chromosomal DNA of C . utilis with Sau3A1 were ligated with YRp7 at the BumHI site to make pYKL30. The fragment containing TRPl and ARSI was removed from pYKL30 by HindIII digestion and recircularized to make pYKL40. The 2.55 kb HindIII fragment of pYKL40 was inserted in pBR322 at the HindIII site to make pYKL45. B, BumHI; Bg, BglII; C, CluI; E, EcoRI; H, HindIII; P, PstI; Pv, PvuII; S, SulI. and the part of the gel containing fragments larger than 1 kb was cut out. The DNA was extracted by freezing and thawing. The cloning vector YRp7 (4 pg) was digested with BumHI. Then the two types of fragment were ligated with T4 DNA ligase and the ligation products were used to transform E. coli RR1. Ampicillin-resistant and tetracycline-sensitive transformants were selected, and tested for complementation of leuB auxotrophy on minimal medium. Southern hybridization. Chromosomal DNAs of E. coli, S. cerevisiae and C. utilis were prepared as described previously (Struhl et al., 1979)and digested with the restriction enzymes EcoRI and BamHI. The fragments were transferred from agarose gel to a nitrocellulose filter (Southern, 1975).The hybridization probe DNA was labelled by using a nick-translation kit (Amersham). Sequencing. DNA was sequenced by the dideoxy chain termination method of Sanger et al. (1977). The sequence kit of Takara Brewery Co. was used. All of the sequences were determined at least twice on the same strand. The sequences were analysed with a PC9801F2 personal computer (Nippon Electronic Co., Japan) and the software Genetyx-I11 (Software Development Co., Japan). RESULTS Cloning of the 3-IMDH gene of C . utilis The E. coli RRl transformants containing C . utilis chromosomal DNA were screened for complementation of the leuB6 auxotrophy. Fortunately, among the 492 transformants first obtained, we found two that grew well in minimal medium lacking leucine, one of which had a 10.7 kbp plasmid. This plasmid, pYKL30, also complemented the leucine deficiency of the S . cerevisiae leu2-3 leu2-112 auxotroph. The restriction map of plasmid pYKL30 is shown in Fig. 1. Localization of the 3-IMDH coding region in pYKL30 was examined as follows. The fragment containing TRPZ and ARSI was removed by HindIII digestion followed by recircularization to Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Wed, 14 Jun 2017 21:49:39 1091 Candida utilis 3-IMDH gene 0 1 1 I l C ECHSaB 3 1 l l E BBe H 4 1 H 5 1 P 1 BnC 1 1 S 1 1 Pv I ~ k1b ; P 1 I 40-E 9 Leu- 40-HI 1 Leu- 40-HlI Leu' 40-Pv ] Leu+ ] Leu+/Leu I Leu- &B- Bg 40-c 0 - Leu- 3-IMDH Fig. 2. Determination of the coding region of the C. utilis 3-IMDH gene. Bold lines represent the nucleotide sequence derived from C. utilis.Open lines represent the DNA of pBR322. Light lines show the deletion region in each derivative of pYKL40. The activity of complementation of the E. coli leuB6 auxotroph is indicated by Leu+ or Leu-. The line with arrowheads shows the coding region of the 3-IMDH. c/o I Suu3Al/BomHI I 1 1 I I I I Hind I I I Bgl I I EroRI I I I I I I I 1 3-IMDH 100 bp Fig. 3. Strategy for sequencing the 3-IMDH coding and flanking regions. Fragments from pYKL45 were inserted in the multiple cloning site of pUC 18 vector. Arrows beneath the bold lines represent the direction and extent of sequences determined. The arrow at the bottom shows the 3-IMDH coding region. Vertical lines represent the positions of restriction sites. make it easy to examine the region. This plasmid was named pYKL40. It should have no autonomously replicating sequence (ARS) that works in S . cerevisiae, because when S . cerevisiae AH22 was transformed with 1 pg pYKL40, less than Leu+ prototrophs appeared. Plasmid pYKL40 was further digested with various restriction enzymes and recircularized to delete nonessential parts. The 3-IMDH activity of the deletion plasmids was examined by complementaDownloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Wed, 14 Jun 2017 21:49:39 ~ ~ 1092 K . H A M A S A W A A N D OTHERS -300 Sau3AI/BamHI ~~TCAAGGGAGCAGAATC~TAAGAGAGC~AGAAATA~CCATGAAGGTTCAACA~TTGTACGATCAGACCAGTC~GTTCATTCA~CGTTGTTTAAT -200 ~ C A T A A T C ~ T T ~ A T C ~ C T T ~ ~ A A A G C A T C C C A C C A C C G C C ~ ~ C C T C T G T ~ T -b TCCACCTC~GTCATTCTC~GC~TGTTTC~CICCATT~~~AT~GCTACTAGC~CA~ACAACCATGCCAGAGAAAACAATTGT~GTTCTTCCAGG YetProGluLYsThrlleValValLeuProGlv I00 TGACCACG~CGGTACTGAGATCACTGCTGAGGCCATCAAGGTCCTCAAGGCCATCGAGGAGGTGAAGC~GGAGATCAAGTTCAA~TC~AACACCACC~G AspHlsVaIGIyThrGIuIleThrAlaGIuAlalleLy~ValLeuLysAlalleGIuGIuVaILYsProGIuIleL~SPheASnPhetlnHlSHlsLeu Clal 200 ATTGGAGGAGCTGC~ATC~ATGCCACCG;;TGTTCCATTGCCAGACGATGCCTTGGAGG~C~CCAAGAAGGCTGATGCTGTTCT~CTCGGTGCTGTTGGTG IleGlYGIYAIaAlalleAspAlaThrGlyVa1ProLeuProAspAspAlaLeuGluAlaSerLysLYsAlaAsPAlaValLeuLe~GlYAlaValGlyGlY 300 GTCCAAAA~GGGGTACCGGTGCCGTCAGACCAGAGCAAGGTCTTCTGAAGATCAGAAAAGAGCTGAAC~TTTACGCCAACTTGAGACC~TGT AACTTTGC PrOLYsTrPGlYThrGlYAlaValArgProGluGlnGlyLeuLeuLyslleArgLysGluLeuAsnLeuTyrAlaAsnLeuAr9ProCYsAsnPheAla 400 TTCTGAGT~CTTGTTGGA~TTGTCTCCAATCAAGGCCGAGGTCGTCAAGGGCACAGAC~TTGTCGTTG~CAGAGAGCT~GTCGGTGGTATCTACTTTGGT SerGluSerLeuLeuAsPLeuSerProlleLysAlaGluValValLysGlyThrAspPheValValValArgGluLeuValGlYGlYllelYrPheGly 500 GA A A G A A A ~ G A G G A T G A C G G T T C A G G C G ~ T G C G T C C G A ~ GluAr9LYSGluAsPAsPGIYSerGlyValAlaSerAspThrGluThrTyrSerValProGluValGlnArglleThrAr~MetAlaAlaPherletAlaLeu 600 TGCAACACAACCCACCAT~GCCAATC~CI;TCTTTGGACAAGGCCAACG~CTTGGCCTC~TCCAGATTG~GGAGAAAGG~TGTCACTG GlnHlsAsnProProLeuProlleTrPSerLeuAspLysAlaAsnValLeuAlaSerSerArgLeuTrpArgLysValValThrGluThrlleGluLys 700 EcoRl GGAATTCCtACAATTGAC~GTCAA~~ACCAGTTGATCGACTCCGCTGC~ATGATCCTCATCAAGTACC~AA~ACAGCT~AACGGTATAGTCATCA~~T~C GluPheProClnLeuThr~alGlnlilsGlnLeulle~sPSerAlaAlaMetlleLeulleLyslyrProThrC,lnLeuAsnGlylleValIleThrSer BOO AACATGTTTGGTGATATCATCTCTGATGAGGCATCTGTCATTCCAGGTTCTCTGGGTTTGTTGCCATCTGCCTCTTTGGCAT~CTGCCAGA~CGAACA AsnMetPheGlYAspllelleSerAspGluAlaSerValIleProGlySerLeuGlyLeuLeuProSerAlaSerLeuAlaSerLeuProAsPSerA~nL~s BamHl 900 , AGGCCTTTGGTTTGTACGAGCCATGCCATGGATCCG~CCAGACTTGCCAGCCAATAAGGTGAACCCAATT~CCACTATCTTGTCTG~~~AATGATGTT AlaPheGlYLeuTyrGluProCYsHlsGlYSerAlaProAsPLeuProAlaAsnLYsValAsnProlleAlaThrlleLeuSerAlaAlaMetMetLeu I000 GAAGTTCTCTTTGGACTTCTACGA~GAA~GTGTTGCGC~TGAGACTGC~GTTAAGCAAGTTCTCGATG~TGGTATCAGAACTG~TGAC~TGAAGGG,~A~A LYsL~uSerLeuAsPLeuTYrGluGluGlYValAlaValGluThrAla~~alLYsGlnValLeuAsPAlaGlYlleAr9ThrGlYAspLeuLYsGlYThr Bg/ 11 1100 AACTCAAC~ACCGAGGTTGGTGATGCTG;T~CTGAAGC~GTCAAGAAGATCTTGGCTJACT~-~~~~A~~~TA~TTT_AA_~ AsnSerThrThrGluValGlyAspAlaValAlaGluAlaValLysLyslleLeuAlaTRM I200 -_----_--ACGAAACGAAG#~TR~CTATTATCATATCTTATGCAGA~GTAGTGATG~GACTTGAAC~GGCTTTGAC~CTAATTCTG~TGAGCAACAAAGTCATCAATG I300 TCAATCTC~AAGATTCGAGCAGAACCAG;\GTTCGAAGTCTTTCTCTGC~TCT~TGCCTCCTGCTTCTCCAGTTTGCGTAACTTGGCTAATGGGCCATAGC I400 CT A C A A C G ~ C C T T G T T C A ~ C T AATGGATCGAGGAA CA A ~ I500 ACCTTCGI CTCC~AACTTCTCC~CAACCAAGT~GTTGTCGTT~AACTTAACC~GTCTTGGCT~CTCGTCGTTGGCGTGTGTCACTGTGACGG~T A ATGAT 1700 CTTCACAA~GACACCAGACTTGATCTTC~TCAATCTAAGCAGTTGAAGAACTTTCTGGACTTTGGAAGGGATCTTTGCACC~AC~GGG~C~GGGGTTC~G Hind111 TCACAAGCT Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Wed, 14 Jun 2017 21:49:39 Cundidu utilis 3-IMDH gene 1093 tion tests of the E. colileuB6 auxotroph (Fig. 2). It was concluded that the 3-IMDH coding region was situated in a BumHI/Suu3Al-HindIII fragment of 2.2 kbp. Therefore, this fragment was recloned in pBR322 at the Hind111 site to form pYKL45 (Fig. 1.). Southern hybridization experiments were done to test whether the sequence complementing the leuB6 mutation of E. coli corresponded to C. utilis DNA. HindIII-digested chromosomal DNAs from C. utilis clearly hybridized with pYKL40, while those from S . cerevisiue and E. colidid not (data not shown), so it was confirmed that the 2.2 kbp fragment originated from C. utilis. D N A sequence of the 3-IMDH gene of C. utilis To analyse the DNA sequence of the 3-IMDH gene of C. utilis, we sequenced the 2.2 kbp fragment of pYKL45 by the dideoxy chain termination method. Fig. 3 shows the sequence strategy. Since the fragment bears three unique cleavage sites of CluI, EcoRI and BglII, it was divided into four pieces by the enzymes. They were subcloned in the multiple cloning site of pUCl8 vector (Yanisch-Perron et ul., 1985). Sequencing of each fragment was repeated two or three times. The DNA sequence of the fragment (Fig. 4) consisted of 2209 bp and contained an open reading frame (ORF) of 1089 bp encoding 363 amino acids. A translatable amino acid sequence is shown under the nucleotide sequence in Fig. 4. The M , of the corresponding polypeptide was calculated to be 38 700. A TATA-box-like sequence, the consensus sequence of the RNA polymerase I1 recognition site, could also be found at two places, namely at positions -258 and -30 (Sentenac & Hall, 1982). DISCUSSION The 3-IMDH gene of C. utilis was cloned and its nucleotide sequence was determined. This is the first report of the nucleotide sequence of a functional gene of C. utilis as far as we know. The sequence of 2209 bp was an alignment of four restriction fragments determined separately. The sequences of HindIII-CluI, CluI-EcoRI, EcoRI-BglII and BglII-Hind111 fragments could be clearly read from one end to the other. However, if there were two proximal CluI sites or an EcoRI or BglII site which could not be detected by mapping with restriction endonucleases, they would be missed. To test this possibility we cleaved pYKL45 with one of ClaI, EcoRI and BglII completely, recircularized with ligase and used this DNA to transform E. coli R R l . As all the ampicillin-resistant transformants were also Leu+, there should be no missing fragments. Nucleotide sequences of the 3-IMDH genes of S . cerevisiue (LEU2)and T. thermophilus (IeuB) have already been determined. When the DNA sequence of the 3-IMDH gene of C. utilis was compared with that of S . cerecisiue, a considerable homology (76.2%) was found. Moreover, since only the third letter of the corresponding codon differs in many cases, the homology of amino acid sequences is as high as 85.4%. Thus the two sequences could be aligned in spite of the difference in species (Fig. 5). The 3-IMDH gene from Cundidu multosu has been cloned (Kawamura et ul., 1983), and its recently determined nucleotide sequence also has a high homology (76%) with the 3-IMDH gene of S . cerevisiue (M. Takagi, personal communication). The C. utilis 3-IMDH was one amino acid shorter than the S . cerevisiue 3-IMDH. In Fig. 5 , the underlined sequence of 14 amino acids (288-301) in S . cerevisiue was considered by Andreadis et ul. (1984) to be the substrate-binding site of the LEU1 and LEU2 gene products. The homology was 85.7% in this region. The nucleotide sequence of the leuB gene of Thermus thermophilus (Kagawa et ul., 1984) was compared with that of the 3-IMDH gene of C. utilis. There is only 12.9% homology in the ORFs, but in some parts more homologous stretches were found (Fig. 6). It is unknown what these Fig. 4. Nucleotide and amino acid sequence of the 3-IMDH gene and its flanking regions. The amino acid sequence of the ORF was translated from the nucleotide sequence. Numbering of both nucleotides and amino acids start from the beginning of the coding sequence. TATA box-like sequences were boxed. Underlines in the 5' non-coding region indicate a G-C-rich palindromic sequence. Broken lines and boxes at the 3' non-coding region represents the presumptive consensus sequence of transcription termination. Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Wed, 14 Jun 2017 21:49:39 1094 K . HAMASAWA A N D OTHERS C. urilis -MPEKT IVVL PGDHVGTEI T AEA IK V L I d EEVKPEI KFN FQHHLI GGAA IDATGVPLPii S.cerevisiae MSAPKK 1 V V L PGDHVGQE1 T AEA I KVLKA I SDVRSNVKFD FENHL I GGAA IDATGVPLI'E * **** ****** *** ********** * ** * ******* ********** 30 1 89 1I9 DALEASKKAD AVLLGAVGGP KWGTGAVRPE QGLLKIRKEL NLYANLRPCN FASESLLDLS ******* * ********** ***** **** ********** ********* *** ****** EALEASKKVD AVLLGAVGGP KWGTGSVRPE QGLLK I l?KEL QLYANLRPCN FASDSLLDLS I20 I79 PI KAEVVKGT DFVVVRELVG GI YFGERK~; DGSGVASDTE TYSVPEVQRI TRMAAFMALQ *** *** ********** ***** **** ** *** * * * ******* ********** PIKPQFAKGT DFVVVRELVG GIYFGKRKED DGDGVAWDSE QYTVPEVQRI TRMAAFMALQ I50 I80 209 239 HNPPLPIWSL DKANVLASSR LWRKVVTETI EKEFPQLTVQ HQLIDSAAMI LIKYPTQLNG * ******** ********** **** * *** *** * ** ********** * * ** *** HEPPLPIWSL DKANVLASSR LWRKTVEEI'I KNEFPTLKVQ HQLIDSAAMI LVKNPTHLNG Iv I TSNMFGD I I SDEASVI P GSLGLLPS~!! LASLPDSNKA FGLYEPCHGS APDLPANK;~ 210 240 * ******** ********** ********** ****** * * ********** ***** *** IIITSNMFGD I I S D E A S V I P GSLGLLPSAS LASIJ'DKNTA 270 FGLYEPCHGS APDLPKNKVD 329 300 359 -P I AT 1LSAAM MLKLSLDLYE EGVAVETAVK QVLDAGI RTG DLKGTNSTTE VGDAVAEAVK ********** ****** * * ** * * *** ********* ** * ***** ******* ** P I AT I LSAAM MLKLSLNLPE EGKA I EDAYE KVLDAG I RTG DLGGSNSTTE VGDAVAEEV3i 363 KILA **** KILA 364 Fig. 5. Comparisons of the putative amino acid sequences of the ORFs between C. utilis and S . cerevisiae.The upper sequence represents C. utilis 3-IMDH and the lower one the S. cerevisiae 3-IMDH. Asterisks indicate homologous amino acids. The underlined region represents a possible substrate (3-isopropylmalate) binding site proposed by Andreadis et al. (1984). partial homologies mean. Table 1 shows a comparison of codon usage among C. utilis, S . cerevisiue and 7'. thermophilus in the 3-IMDH coding region. C. utilis and S . cerevisiue are eukaryotes, and the codon usages are quite different from that of the prokaryote T. thermophilus, especially in the codons of leucine, glycine, proline and arginine. In the third letter of the codons, C. utilis preferred GC as compared to an AT choice in S. cerevisiue. As expected there is a high occurrence of GC residues in the third letter of the codons in the 3-IMDH of 7'. thermophilus (Table 1). It has been found that in the 5' non-coding region of the 3-IMDH gene (LEUZ)of S . cerevisiue a leader peptide rich in leucine precedes the translation initiation site, and a stem and loop structure can be formed at the end of the leader peptide (Yanofsky, 1983). This region resembles the attenuator structure which regulates some E. coli genes concerning amino acid synthesis. However, Erhart & Hollenberg (1983) later reported that this region is not relevant, because deletions in it did not affect the regulation of 3-IMDH gene expression. We searched the Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Wed, 14 Jun 2017 21:49:39 Candida utilis 3-IMDH gene l - G l v - G l ~ - A la-A1 a- I le-Asp-Al a-1 -Giy-Gii-Ala-Ala-I le-Asp-Ala-Gly-Gly-Ala-Ala-lle-Asp-Ala- 1095 (52) -Ala-Asp-Ala-Val-Leu-Leu-Gly-Ala-Val-Gly-GlY-Pro-LYs-TrP-GlyLa-Val-Gly-GI Y-Pro-Lys-Trp-G1y- ‘-Val~Asp-Ala-Val-Leu-Leu-Gly-A -Pro-Gly-Ser-Leu-GlY-Leu-Leu-Pro-Ser-Ala-Ser-Leu-Pro-Gly-Ser-Leu-Gly-Leu-Leu-Pro-Ser-Ala-Ser-Leu- -Pro-Gly-Ser-Leu-Gly-Leu-Leu-Pro-Ser-Ala-Ser-Leu-G I u- Pro- C y s - H 1 s -GI y - S e r -A 1 a - Pro- As p-GIu - p r 0 - C ~- H~i s-GIy-Ser -A1 a-Pro- As P-Glu-ProfVa L f H I s-GI y - S e r - A 1 a-Pro-Asp-- (82) (8.1) (270) (271) (260) (292) (293) (276) -Pro-lle-Ala-Thr-lle-Leu-Ser-Ala-Ala-MET-MET-Leu-Pro-lle-Ala-Tlir-Ile-Leu-Ser-Ala-Ala-MET-MET-Leu- (311) (312) - P r o ~ A l a ~ A l a ~ I l e - L e u - S e r - A l a - A l a - M E T - M E T - L e u -(295) Fig. 6. Homologous sequences in the ORFs of C . utilis (a), S . cerevisiae (b) and T. thermophilus (c), Identical amino acid sequences are boxed. Table 1. Comparison of codon usage in the 3-IMDH gene of C . utilis, S . cerevisiae and T. thermophilus Frequency Frequency Frequency Frequency Amino h Amino r-h-h acid Codon C S T acid Codon C S T Amino acid Codon C S T Amino Codon C S T acid Leu Tyr TAT TAC 0 0 1 6 4 5 Cys TGT TGC 1 1 His CAT CAC 1 3 0 5 3 5 Trp TGG 3 4 Gln CAA CAG 7 9 2 0 Arg Asn AAT AAC CGT 0 2 CGC 0 0 CGA 0 0 CGG 0 0 AGA 10 9 AGG 0 0 Lys AAA 3 10 0 AAG 21 18 15 Ala GCT 16 13 2 GCC 17 16 28 GCA 4 5 1 GCG 2 2 1 1 TTA TTG CTT CTC CTA CTG 0 9 0 25 21 4 4 5 4 5 0 15 0 4 1 6 1 10 Phe TTT TTC Ile ATT ATC ATA 4 8 0 20 16 7 1 1 1 Met ATG 7 7 6 Val GTT 16 18 0 GTC 14 7 12 GTA 0 0 0 GTG 2 4 20 5 4 Gly Pro GGT 22 28 1 GGC 2 0 1 0 GGA 4 1 7 GGG 0 0 19 CCT ccc CCA CCG 5 3 5 10 Thr ACT ACC ACA ACG 0 0 21 1 7 0 16 0 4 18 1 7 7 4 0 8 8 6 5 4 0 0 0 6 Asp GAT 9 17 1 GAC 1 1 7 I5 Glu GAA 5 20 3 GAG 21 3 28 1 2 1 5 0 11 8 6 Ser TCT TCC TCA TCG AGT AGC 1 0 1 0 10 9 2 0 0 3 0 1 12 8 2 1 1 1 7 2 11 0 6 2 8 0 1 0 4 C, C.utilis; S , S . cerevisiae; T, T . thermophilus. 5’ non-coding region of the C. utilis 3-IMDH gene for similar structures, but could not find them. Martinez-Arias et al. (1983, 1984) suggested on the basis of experiments on deletion mutants, that a palindromic sequence upstream of the TATA box, 5’-TGAGAGGCCGGAACCGGCTTTTCA-3’, participates in the regulation of the expression of the S . cerevisiue LEU2 gene. In the 5’ non-coding region of C . utilis similar sequences were located at -204 to - 181, - 164 to - 15 1 and - 143to - 129, but they were downstream of the TATA box at - 256. Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Wed, 14 Jun 2017 21:49:39 1096 K . HAMASAWA AND OTHERS A tRNALeugene containing an intervening sequence has been reported in the 5’ non-coding region of the S. cerevisiue LEU2 gene (Andreadis et ul., 1982): we searched for a homologue of the C. utilis tRNALeusequence described by Murasugi & Takemura (1978) but failed to find a corresponding sequence. Zaret & Sherman (1982) suggested that the 3’ non-coding regions of several genes contain transcription termination sequences. S . cerevisiue also has such a sequence in the 3’ non-coding region of the LEU2 gene. In C . utilis, the consensus signal sequence for termination and poly(A) addition, TAA/TAG/TGA***1-140***(T-rich)****TAGT/ TATGT***(A-T-rich)*****TTT*****poly(A) was also found in this region (Fig. 4). Many kinds of dehydrogenases have a structure which is thought to be part of the coenzyme-binding domains. Recently it was proposed that ADP, a component of NAD or flavin-adenine dinucleotide (FAD), would bind a structure of fl-strand-a- helix-fl-strand which was termed an ADP-binding flap-fold (Froman et ul., 1984). The authors compared many ADP-binding proteins and found two common characteristics of all complexes: (i) the occurrence of glycine residues at the N-terminus of the helix (e.g. Gly*Gly**Gly), which results in a favourable interaction between the a-helix dipole and the negatively charged pyrophosphate moieties, and (ii) the occurrence of the eight amino acids at a specific position in a peptide fragment. The total length of this amino acid sequence varies between 29 and 31 residues. We searched the C. utilis 3-IMDH gene for a sequence with these characteristics, but failed to find it, so the amino acid sequence of the ADP-binding flap-fold may be different from the others reported (Wierenga et ul., 1985, 1986). There are many homologous sequences among the 3-IMDHs of C. utilis, S . cerevisiue and T. thermophifus (Fig. 6). It is unknown what these homologies mean, but they may in some way concern essential sequences such as the catalytic domain or the nucleotide binding site. As we now have the nucleotide sequence of the 3-IMDH gene of C. utilis, it may be possible to get Leu- auxotrophic mutants of C. utilis by the gene disruption technique (Rothstein, 1983). Then, the 3-IMDH gene will be useful as a selective marker in gene manipulation of C. utilis. REFERENCES ANDREADIS, A., Hus, Y.-P., KOHLHAW,G. B. & KAWAMURA, M., TAKAGI,M. & YANO,K. (1983). SCHIMMEL, P. (1982). Nucleotide sequence of yeast Cloning of a LEU gene and an ARS site of Candida LEU2 shows 5’ non-coding region has sequences maltosa. Gene 24, 157-162. cognate to leucine. Cell 31, 319-325. MARTINEZ-ARIAS, A., Yosr, H. J. &CASADABAN, M. J. ANDREADIS, A., Hus, Y.-P., HERMODSON, M., KOHL(1983). Fusion of the Saccharomyces cerevisiae leu2 HAW, G. B. & SCHIMMEL, P. (1984). Yeast LEUZ. gene to an Escherichia coli P-galactosidase gene. Repression of mRNA levels by leucine and primary Molecular and Cellular Biology 3, 580-586. structure of the gene product. Journal of Biological MARTINEZ-ARIAS, A., YOST,H. J. & CASADABAN, M. J. Chemistry 259, 8059-8062. (1984). Role of an upstream regulatory element in DAVIS, B. D. (1948). Isolation of biochemically leucine repression of the Saccharomyces cerevisiae deficient mutants of bacteria by penicillin. Journal of leu2 gene. Nature, London 307, 740-742. the American Chemical Society 70, 4267. MURASUGI, A. & TAKEMURA, S. (1978). Nucleotide ERHART, E. & HOLLENBERG, C. P. (1983). The presence sequence transfer RNA 1 from Candida (Torulopsis) of a defective LEU2 gene on 2 p DNA recombinant utilis. Journal of Biochemistry 83, 1029-1038. plasmids of Saccharomyces cerevisiae is responsible ROTHSTEIN, R. J. (1983). One-step gene disruption in for curing and high copy number. Journal of yeast. Methods in Enzymology 101, 202-21 1. Bacteriology 156, 625-635. SANGER, F., NICKLEN, S. & COULSON, A. R. (1977). FINK,H., LECHNER, R. & HEINISCH, E. (1936). Uber DNA sequencing with chain-terminating inhibitors. die Futterhefe Gewinnung in Holzzuckerlosungen. Proceedings of the National Academy of the United 11. Biochemische Zeitschrijit 283,7 1-82. States of America 74, 5463-5467. FROMAN,R. C., TAIT, R. C. & RODRIGUEZ, R. L. SENTENAC, A, & HALL,B. (1982). Yeast nuclear RNA (1984). Nucleotide sequence of the 3’-terminal region polymerases and their role in transcription. In The of the LEU2 gene from Saccharomyces cerevisiae. Molecular Biology of the Yeast Saccharomyces, MetaGene 31, 257-261. bolism and Gene E.vpression, pp. 561-606. Edited by KAGAWA, Y., NOJIMA, H., NUKIWA, N., ISHIZUKA, M., J. N. Strathern, E. W. Jones & J. R. Broach. Cold NAKAJIMA,T., YASUHARA, T., TANAKA,T. & Spring Harbor, NY: Cold Spring Harbor O~HIMA, T. (1984). High guanine plus cytosine Laboratory. content in the third letter of codons of an extreme thermophile. Journal of Biological Chemistry 259, SOUTHERN, E. M. (1975). Detection of specific se8059-8062. quences among DNA fragments separated by gel Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Wed, 14 Jun 2017 21:49:39 Candida utilis 3-IMDH gene 1097 electrophoresis. Journal of Molecular Biology 98, binding pap-fold in proteins, using an amino acid 503-5 17. sequence fingerprint. Journal of Molecular Biology 187, 101-107. STRUHL,K., STINCHCOMB, D. T., SCHERER, S. & DAVIS, YANOFSKY,C. (1983). Prokaryotic mechanisms in R. W. (1979). High-frequency transformation of eukaryotes. Nature, London 302, 75 1-752. yeast: autonomous replication of hybrid D N A molecules. Proceedingsof the National Academy of the YANISCH-PERRON, C., VIEIRA,J . & MESSING,J. (1985). Improved M 13 phage cloning vectors and host United States of America 76, 1035-1039. strains : nucleotide sequences of the M 13mpl8 and WIERANGA,R. K., DEMAEYER,M. C. H. & HOL, pUC19 vectors. Gene 33, 103-109. W . G. J . (1985). Interaction of pyrophosphate ZARET,K . S. & SHERMAN,F. (1982). DNA sequence moieties with a-helices in dinucleotide binding required for efficient transcription termination in proteins. Biochemistry 24, 1346-1 357. yeast. Cell 28, 563-573. WIERENGA,R. K., TERPSTRA,P. & HOL, W. G. J . (1986). Prediction of the Occurrence of the ADP- Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Wed, 14 Jun 2017 21:49:39