* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download DNA functions worksheet
Genomic library wikipedia , lookup
History of RNA biology wikipedia , lookup
Non-coding RNA wikipedia , lookup
DNA polymerase wikipedia , lookup
SNP genotyping wikipedia , lookup
Microevolution wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Transfer RNA wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Molecular cloning wikipedia , lookup
History of genetic engineering wikipedia , lookup
DNA vaccination wikipedia , lookup
Frameshift mutation wikipedia , lookup
Epigenomics wikipedia , lookup
Non-coding DNA wikipedia , lookup
Messenger RNA wikipedia , lookup
DNA nanotechnology wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
DNA supercoil wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Epitranscriptome wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Primary transcript wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Helitron (biology) wikipedia , lookup
Point mutation wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Expanded genetic code wikipedia , lookup
Worksheet – DNA and Protein Synthesis Biology 12 Name: DNA Structure 1. DNA is often called the "code of life". Actually it contains the code for A. the sequence of amino acids in a protein B. the sequence of base pairs C. producing mutations D. making a recipe 2. What is the main difference between the structure of chromatin and the structure of chromosomes? When would DNA be found as chromatin? When would it be found as chromosomes? 3. One nucleotide of DNA is made of three smaller parts. What are these parts? What are the full names of the bases found in DNA? Which ones bond with each other? 4. What does the diagram below represent? Where in the cell does this occur? Under each part of the diagram, write down a few words about what is happening. Protein Synthesis – you will need to use your chart of mRNA codons/amino acids for many of the following questions. 1. Complete the following chart contrasting the two parts of protein synthesis: Transcription Translation Location in cell where it occurs Types of RNA associated with this Product 2. What is the name of the structure that a) carries amino acids to the ribosome? b) forms between adjacent amino acids? c) is the original instructions for a protein? d) contains a series of codons? e) is the site of translation? 3. Use the following DNA sequence to answer the questions below: TAACCGGATAGTCTAATT a) What is the mRNA sequence that would be transcribed from the DNA above? b) Use your chart of mRNA codons to list the 6 amino acids in the sequence. c) What type of bond would join these amino acids together? d) What would be the sequence of bases (letters) on the tRNA anticodons that would bring the above amino acids to the ribosome? 4. How many amino acids will be in a polypeptide with the following DNA sequence: ATTGCCATGACAATAGGCATAAACAGGTCA 5. Which of the following best describes the function of mRNA? A. it stays in the nucleus and is copied by DNA B. it carries amino acids to the growing polypeptide chain C. it makes up the ribosomes and provides the site for protein synthesis D. it is transcribed from the DNA and carries the information to the ribosome 6. Read the following DNA sequence left to right: TATCTT what will be the correct mRNA sequence? what will be the correct amino acid sequence? 7. Using the table of codons, determine the sequence of amino acids coded for by this mRNA sequence: C-U-C-C-G-A-U-A-C Amino acid sequence: 8. The role of ribosomes in protein synthesis is to A. split the two strands of DNA apart. B. check for and replace faulty codons. C. carry amino acids to the site of translation. D. provide a site for mRNA and tRNA to join together. 9. What is the DNA sequence that would produce the following amino acid strand: alanine – methionine – alanine A. B. C. D. GCAAUGGCG GCGAUGCGC CGGTACCGA CGCTAGGCA 10. Fill in the following chart that compares DNA and RNA: DNA # of strands type of sugar location in cell bases types RNA 11. The DNA strand C GA T G C G A C A T T undergoes a mutation in which the section coding for the amino acid threonine is lost. Which of the following would be the correct codons after this mutation? A. A C G C U G U AA B. G C U A C G C UG C. G C U C U G U AA D. G C U A C G U AA 12. The following is a sequence of mRNA bases: G CU U C U C CU What sequence of amino acids results after translation occurs? 9. Consider the following portion of an mRNA strand: UAC GGG AUA What are the anticodons that will be paired to this strand? A. AT G CCC TAT B. AT A GGG TAC C. AUG CCC UAU D. UAC GGG AUA 10. Complete the following chart comparing DNA replication and protein synthesis: DNA replication Protein synthesis Location where it occurs Product Types of nucleic acids used during this process 11. Look at the graph to the right. a) Which line, the solid or the dashed, represents the protein produced? b) at which time (W, X, Y, or Z) is transcription, but not translation, occurring? c) at which time is translation, but not transcription, occurring? 12. A sample of DNA was analyzed and scientists found that 32% of the nitrogenous bases were guanine. What percentage of the following bases would also be in the sample? Thymine: Cytosine: Uracil: Adenine: