* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download DNA Computer Review
Survey
Document related concepts
Transcript
DNA Computer Review I. Mitosis vs Meiosis a. Go to http://www.pbs.org/wgbh/nova/miracle/divide.html b. Click on “Go to mitosis vs. meiosis” c. Define: i. Centrioles; ii. Spindle Fibers d. Work through the animation and fill in the chart: Mitosis Meiosis Where does it occur Starts with Ends with Chromosome # (beginning vs end) Genetic Variation? e. Looking at the full processes, how does meiosis look different than mitosis? II. DNA Structure/Replication a. Go to http://library.med.utah.edu/NetBiochem/pupyr/pp.htm b. What are the 3 parts of a nucleotide? ______________________________ c. Which of the 4 nitrogen bases are purines? Pyrimidines? d. Adenine bonds with? ____________ Cytosine bonds with? ______ e. What holds the nitrogen bases together? f. Go to http://nobelprize.org/educational_games/medicine/dna_double_helix/ g. Click on “Play the DNA-doube heix game” h. What needs to happen first for DNA replication to occur? i. When does DNA replication occur? j. Give the complementary DNA strand for the following: ATCACTGGACTGACTGACCC III. DNA vs RNA a. Go to http://academic.brooklyn.cuny.edu/biology/bio4fv/page/molecular%20biology/dnastructure.html b. Go to http://www.accessexcellence.org/RC/VL/GG/rna2.php c. List 3-4 differences that DNA and RNA have d. Go to http://library.thinkquest.org/04apr/00217/en/biology/rna/index.html e. List the function of each type of RNA i. mRNA ii. tRNA iii. rRNA IV. Replication vs Transcription a. Go to http://www.fed.cuhk.edu.hk/~johnson/teaching/genetics/animations/dna_replication.htm b. Go to http://www.fed.cuhk.edu.hk/~johnson/teaching/genetics/animations/transcription.htm V. Transcription a. Go to http://www-class.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a2.html b. What happens during transcription? ______________________________ ____________________________________________________________ c. Where does transcription occur? d. Transcribe the following DNA strand: ATCGATTTGCAACCAGGAAG VI. Translation a. Go to http://www.courses.fas.harvard.edu/~biotext/animations/TRANSLATE20b.swf b. What do tRNA’s do? c. What part of the tRNA binds to the codons of the mRNA? d. Go to http://learn.genetics.utah.edu/content/begin/dna/transcribe/ e. Go to http://www.biostudio.com/demo_freeman_protein_synthesis.htm f. Go to http://library.thinkquest.org/20465/g_DNATranscription.html g. Go to http://www.wisc-online.com/objects/index_tj.asp?objID=AP1302 h. Give the following information based on this DNA strand: DNA: TAC-GGG-CAT-CGC-AAC-ACG-TTA-TAG-ATT i. mRNA: ii. tRNA’s: iii. protein: i. What type of bond holds amino acids together in a protein? j. Where does translation occur? VII. Mutations a. Go to http://highered.mcgrawhill.com/sites/0072556781/student_view0/chapter11/animation_quiz_3.html b. Go to http://highered.mcgrawhill.com/sites/0072556781/student_view0/chapter11/animation_quiz_4.html c. Go to http://staff.jccc.net/PDECELL/evolution/mutations/mutation.html d. Define the following: i. Missense mutations: ii. Nonsense mutations: iii. Silent mutations: iv. Substitution mutations: v. Frameshift mutations: vi. Translocations: