Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
JPET142950 Supplemental Information Table 1: Q-PCR TaqMan primers and probe sequences. * house keeping genes and † predetermined target genes. Gene name Forward primer Reverse primer TaqMan probe GAPDH* CAAGGTCATCCATGACAACTTTG GGGCCATCCACAGTCTTCTG ACCACAGTCCATGCCATCACTGCCA B-actin* GAGCTACGAGCTGCCTGACG GTAGTTTCGTGGATGCCACAGGACT CATCACCATTGGCAATGAGCGGTTCC Cyclophilin* CATCTGCACTGCCAAGACTGA CCACAATATTCATGCCTTCTTTCA CCAAACACCACATGCTTGCCATCCA GMCSF† AGCCTCACCAAGCTCAAGGG GGGTTGGAGGGCAGTGCT CCCTTGACCATGATGGCCAGCC IL-1β† AAGCAGAAAACATGCCCGTCT AATTGCATGGTGAAGTCAGTTATATCCT CCGCCTTTGGTCCCTCCCAGG IL-6† TGACCCAACCACAAATGCCA CATGTCCTGCAGCCACTGG CTGTGCCTGCAGCTTCGTCAGCA IL-8† TCCTTGTTCCACTGTGCCTTG TGCTTCCACATGTCCTCACAA TTAGCCACCATCTTACCTCACAGTGAT TNF-α† GGTGCTTGTTCCTCAGCCTC CAGGCAGAAGAGCGTGGTG CTCCTTCCTGATCGTGGCAGGCG 1 Immunohistochemistry Identification of AM Alveolar macrophages where plated at 1x105 cells per chamber within cell culture chamber slides (VWR, Leicestershire, UK). After 24hrs non adherent cells were discarded and excess media removed with PBS. Cells were fixed in ice-cold methanol for 10 minutes at -20°C for 10mins. Following 3x5mins washes in PBS, cells were blocked in 2.5% normal horse serum (NHS) for 30mins at room temperature. Cells were incubated in a mouse anti-human CD68 antibody (Clone 514H12, Novocastra, Newcastle, UK) diluted in 2.5% NHS overnight at 4°C. Endogenous peroxidase was quenched using 3% H2O2 in methanol for 30mins prior to incubation in a peroxidase conjugated anti-mouse IgG ImmPress kit (Vector Laboratories, Peterborough, UK). CD68 was visualised using 3,3’-diaminobenzidine tetrahydrochloride (DAB) chromogen substrate (Vector Laboratories). Cell nuclei were counter stained using haematoxylin (Sigma, Poole, UK). Luminex Analysis Fluorescent microspheres (Luminex Corporation, Austin, Texas, via Applied Cytometry Systems, Sheffield, UK, Cat No. PN-105-104-01, PN-105-106-01, PN105-107-01, PN-105-108-01) were labelled with primary antibodies to either IL-1β, IL-6, IL-8 or TNFα. Samples and standards were added to the microspheres in a filter plate and agitated for 2hrs. Plates were washed with PBS+0.05% Tween 20 (Sigma) using low vacuum filtration. Biotinylated secondary antibodies were diluted to 0.5ug/ml, mixed with the micropheres and agitated for 1hr. After washing, streptavidin-PE (PJ31S, Prozyme, San Leandro, CA, USA) was added at 50ug/ml and the plates agitated for 30mins. Plates were washed, then the micropheres resuspended 2 in Luminex sheath fluid (Luminex Corporation via Applied Cytometry Systems, Cat No. PN-100-006) and the plates read on the Luminex 100 Analyser (Luminex Corporation). Antibodies were from Endogen (Endogen, Pierce Biotechnology/Thermo Fisher Scientific, Rochford, IL, USA, Cat No. M-42OB-B, M620-E, M-621-B, M-801-E and M-802-B) except for IL-1b and TNFa primaries and the TNFa secondary which were from R&D Systems (Cat. No. MAB201 (Clone 8516.311), MAB610 and BAF210 respectively). All standards were from R&D Systems. All reagents were diluted in PBS with 1%BSA (Sigma). 3