shERWOOD-UltramiR shRNA
... Knockdown efficiencies of shERWOOD-UltramiR hairpins were benchmarked against existing TRC and GIPZ early generation shRNA-mir hairpins targeting 3 different genes. shERWOOD-UltramiR designs produced very potent and consistent knockdown relative to available TRC and GIPZ hairpins targeting the same ...
... Knockdown efficiencies of shERWOOD-UltramiR hairpins were benchmarked against existing TRC and GIPZ early generation shRNA-mir hairpins targeting 3 different genes. shERWOOD-UltramiR designs produced very potent and consistent knockdown relative to available TRC and GIPZ hairpins targeting the same ...
TRANSCRIPTION – TRANSLATION
... information into the cytoplasm, where the cell uses it to construct specific proteins, RNA synthesis is transcription; protein synthesis is translation. RNA differs from DNA in that it is single stranded, contains Uracil instead of Thymine and ribose instead of deoxyribose, and has different functio ...
... information into the cytoplasm, where the cell uses it to construct specific proteins, RNA synthesis is transcription; protein synthesis is translation. RNA differs from DNA in that it is single stranded, contains Uracil instead of Thymine and ribose instead of deoxyribose, and has different functio ...
SuperScript™ III Platinum® One-Step Quantitative RT
... The SuperScript™ III Platinum® One-Step Quantitative RT-PCR System is a one-step, quantitative real-time RT-PCR system for the sensitive and reproducible detection and quantification of RNA using real-time detection instruments. This system combines the high-temperature reverse transcription capabil ...
... The SuperScript™ III Platinum® One-Step Quantitative RT-PCR System is a one-step, quantitative real-time RT-PCR system for the sensitive and reproducible detection and quantification of RNA using real-time detection instruments. This system combines the high-temperature reverse transcription capabil ...
A gene expression atlas of a bicoid-depleted
... discrete terminal fates, a process called canalization. We studied the behavior of the anterior-posterior segmentation network in Drosophila melanogaster embryos by depleting a key maternal input, bicoid (bcd), and measuring gene expression patterns of the network at cellular resolution. This method ...
... discrete terminal fates, a process called canalization. We studied the behavior of the anterior-posterior segmentation network in Drosophila melanogaster embryos by depleting a key maternal input, bicoid (bcd), and measuring gene expression patterns of the network at cellular resolution. This method ...
New SigD-regulated genes identified in the
... and Chamberlin, 1989), methyl-accepting chemotaxis receptor proteins (Marquez et al., 1990), and autolysin synthesis (Marquez et al., 1990; Kuroda and Sekiguchi, 1993). The unique binding motif of σ D [TAAA(-35)-N15-GCCGATAT(-10)] has been summarised, which allows researchers to detect those genes w ...
... and Chamberlin, 1989), methyl-accepting chemotaxis receptor proteins (Marquez et al., 1990), and autolysin synthesis (Marquez et al., 1990; Kuroda and Sekiguchi, 1993). The unique binding motif of σ D [TAAA(-35)-N15-GCCGATAT(-10)] has been summarised, which allows researchers to detect those genes w ...
C. elegans the L1 larval stage
... Axon guidance is the developmental process where developing neurons navigate their processes based on attractive and repulsive cues. C. elegans has been an instrumental model in the study of neurobiology with one of the key benefits being a relatively simple nervous system which comprises of only 30 ...
... Axon guidance is the developmental process where developing neurons navigate their processes based on attractive and repulsive cues. C. elegans has been an instrumental model in the study of neurobiology with one of the key benefits being a relatively simple nervous system which comprises of only 30 ...
ppt - Chair of Computational Biology
... in regulating gene expression and plant development, siRNAs play a major role in defending the genome against the proliferation of invading viruses and endogenous transposable elements. The function of the fourth type of sRNAs, natural-antisense siRNAs (natsiRNAs), is not entirely clear but is likel ...
... in regulating gene expression and plant development, siRNAs play a major role in defending the genome against the proliferation of invading viruses and endogenous transposable elements. The function of the fourth type of sRNAs, natural-antisense siRNAs (natsiRNAs), is not entirely clear but is likel ...
CHAPTER 1 LITERATURE SURVEY
... virus (VACV), the possibility of avoiding any wild type virus background by de novo generation of viruses entirely from cloned sequences. In addition, RNA virus vectors have the advantage as vaccine vectors in that they don't appear to (down) modulate the immune system, as do many large DNA viruses, ...
... virus (VACV), the possibility of avoiding any wild type virus background by de novo generation of viruses entirely from cloned sequences. In addition, RNA virus vectors have the advantage as vaccine vectors in that they don't appear to (down) modulate the immune system, as do many large DNA viruses, ...
"Silencing of Gene Expression in Cultured Cells Using Small
... databases, siRNAs can be designed using Web-based siRNA design programs. There are several siRNA selection algorithms to help predict siRNA sequences for effective silencing. Users need to provide the target messenger RNA sequence and are able to create some user-defined design criteria such as ther ...
... databases, siRNAs can be designed using Web-based siRNA design programs. There are several siRNA selection algorithms to help predict siRNA sequences for effective silencing. Users need to provide the target messenger RNA sequence and are able to create some user-defined design criteria such as ther ...
ParameciumDB - Nucleic Acids Research
... RNA interference (RNAi) by feeding with bacteria that produce double-stranded RNA (9) have become routine laboratory procedures. Paramecium is a privileged model for investigation of nonMendelian heredity and the underlying epigenetic mechanisms. Sonneborn (10) was the first to document cytoplasmic ...
... RNA interference (RNAi) by feeding with bacteria that produce double-stranded RNA (9) have become routine laboratory procedures. Paramecium is a privileged model for investigation of nonMendelian heredity and the underlying epigenetic mechanisms. Sonneborn (10) was the first to document cytoplasmic ...
Plant Virology
... achieved using plant protoplasts (primary cell cultures with cell walls removed) ...
... achieved using plant protoplasts (primary cell cultures with cell walls removed) ...
Plant derived medicines to treat cancer
... to sequence all the messenger RNA within a plant, and thus sequence all the genes that are actually expressed. RNA-seq also allows tracking of the expression levels of each of those genes in different plant tissues. These patterns of expression can be used to identify genes that are likely to be inv ...
... to sequence all the messenger RNA within a plant, and thus sequence all the genes that are actually expressed. RNA-seq also allows tracking of the expression levels of each of those genes in different plant tissues. These patterns of expression can be used to identify genes that are likely to be inv ...
Normalization of gene expression measurements in tumor tissues
... necessary to correct expression data for differences in cellular input, RNA quality, and RT efficiency between samples. In many studies, a single housekeeping gene is used for normalization. However, no unequivocal single reference gene (with proven invariable expression between cells) has been iden ...
... necessary to correct expression data for differences in cellular input, RNA quality, and RT efficiency between samples. In many studies, a single housekeeping gene is used for normalization. However, no unequivocal single reference gene (with proven invariable expression between cells) has been iden ...
Plant Physiology and Biochemistry
... cor78, and lti78 genes are differentially induced under conditions of dehydration, cold, salt, and exogenous ABA. Dehydration responsive element (DRE: TACCGACAT) functions in the initial rapid response of rd29A to dehydration, salt, and low temperature [32,33]. The DRE is an essential cis-acting ele ...
... cor78, and lti78 genes are differentially induced under conditions of dehydration, cold, salt, and exogenous ABA. Dehydration responsive element (DRE: TACCGACAT) functions in the initial rapid response of rd29A to dehydration, salt, and low temperature [32,33]. The DRE is an essential cis-acting ele ...
supplement 3 - Springer Static Content Server
... this new component space (see Figure 2), it was shown that the second and third components, PC2 and PC3, beautifully recognize the 6 classes of tissue specific genes. The first component, which is associated with the eigenvector e1 [0.58, 0.58, 0.58] , however only captures the gene’s average expr ...
... this new component space (see Figure 2), it was shown that the second and third components, PC2 and PC3, beautifully recognize the 6 classes of tissue specific genes. The first component, which is associated with the eigenvector e1 [0.58, 0.58, 0.58] , however only captures the gene’s average expr ...
Cell-Specific Expression of Genes of the Lipid Transfer Protein
... total RNA were copurified from plant tissues using the method of Gustincich et al. (1991). Genomic DNA was digested with restriction endonucleases and DNA fragments were electrophoretically separated in 0.9% agarose gels. Ten micrograms of LiClpurified total RNA was resolved on formaldehyde-agarose ...
... total RNA were copurified from plant tissues using the method of Gustincich et al. (1991). Genomic DNA was digested with restriction endonucleases and DNA fragments were electrophoretically separated in 0.9% agarose gels. Ten micrograms of LiClpurified total RNA was resolved on formaldehyde-agarose ...
Web API In addition to the web interface, one can access Cas
... {"targets": [{"gc_contents": 40.0, "strand": "-", "oof_score": 74.2595596756, "sequence": "ACGAAATATCAATGATGGCCAGG", "coverage": 1, "position": 144050592, "offtarget_counts": [1, 0, 0], "id": 34, "chromosome": "chr7", "cds_percentages": {"ENST00000408906": 20.9401709402}}, {"gc_contents": 30.0, "str ...
... {"targets": [{"gc_contents": 40.0, "strand": "-", "oof_score": 74.2595596756, "sequence": "ACGAAATATCAATGATGGCCAGG", "coverage": 1, "position": 144050592, "offtarget_counts": [1, 0, 0], "id": 34, "chromosome": "chr7", "cds_percentages": {"ENST00000408906": 20.9401709402}}, {"gc_contents": 30.0, "str ...
20.6 NnV mx
... Figure 1 Operons — organizing genes for joint activation. a, A classical operon, found in prokaryotes (such as bacteria). Several genes, often functionally related, form a tight cluster on the genome. Operons are under the control of regulatory elements (promoter, operator) and factors that bind to ...
... Figure 1 Operons — organizing genes for joint activation. a, A classical operon, found in prokaryotes (such as bacteria). Several genes, often functionally related, form a tight cluster on the genome. Operons are under the control of regulatory elements (promoter, operator) and factors that bind to ...
Automation of Reverse Transcription of Avian Influenza Viral RNA
... µL of nuclease free water to each of the Rx-Mix vials with the workstation and mixed with pipetting action of the workstation. Aliquote of 100 µL of each of the reaction mix was transferred into vials placed on the cooling block for preparing working master mixes. To each of the above-said vials con ...
... µL of nuclease free water to each of the Rx-Mix vials with the workstation and mixed with pipetting action of the workstation. Aliquote of 100 µL of each of the reaction mix was transferred into vials placed on the cooling block for preparing working master mixes. To each of the above-said vials con ...
Host-induced epidemic spread of the cholera bacterium
... unequal size that encode for an approximate of 3885 genes. ...
... unequal size that encode for an approximate of 3885 genes. ...
Depletion of the co-chaperone CDC-37 reveals two
... domains. We present results indicating that a homolog of the Hsp90 co-chaperone Cdc37 plays a role in dynamic interactions among the PAR proteins. We show that CDC-37 is required for the establishment phase of embryonic polarity; that CDC-37 reduction allows PAR-3-independent cortical accumulation o ...
... domains. We present results indicating that a homolog of the Hsp90 co-chaperone Cdc37 plays a role in dynamic interactions among the PAR proteins. We show that CDC-37 is required for the establishment phase of embryonic polarity; that CDC-37 reduction allows PAR-3-independent cortical accumulation o ...
Tyrosine cross-linking of extracellular matrix is catalyzed by Duox, a
... levels of reactive oxygen species participate in bacterial killing. In recent years, it has become clear that nonphagocytic cells also generate reactive oxygen, albeit at lower levels (Cross and Jones, 1991). The origin and function of this reactive oxygen has not been clear and has been attributed ...
... levels of reactive oxygen species participate in bacterial killing. In recent years, it has become clear that nonphagocytic cells also generate reactive oxygen, albeit at lower levels (Cross and Jones, 1991). The origin and function of this reactive oxygen has not been clear and has been attributed ...
RNA interference
RNA interference (RNAi) is a biological process in which RNA molecules inhibit gene expression, typically by causing the destruction of specific mRNA molecules. Historically, it was known by other names, including co-suppression, post-transcriptional gene silencing (PTGS), and quelling. Only after these apparently unrelated processes were fully understood did it become clear that they all described the RNAi phenomenon. Andrew Fire and Craig C. Mello shared the 2006 Nobel Prize in Physiology or Medicine for their work on RNA interference in the nematode worm Caenorhabditis elegans, which they published in 1998.Two types of small ribonucleic acid (RNA) molecules – microRNA (miRNA) and small interfering RNA (siRNA) – are central to RNA interference. RNAs are the direct products of genes, and these small RNAs can bind to other specific messenger RNA (mRNA) molecules and either increase or decrease their activity, for example by preventing an mRNA from producing a protein. RNA interference has an important role in defending cells against parasitic nucleotide sequences – viruses and transposons. It also influences development.The RNAi pathway is found in many eukaryotes, including animals, and is initiated by the enzyme Dicer, which cleaves long double-stranded RNA (dsRNA) molecules into short double-stranded fragments of ~20 nucleotide siRNAs. Each siRNA is unwound into two single-stranded RNAs (ssRNAs), the passenger strand and the guide strand. The passenger strand is degraded and the guide strand is incorporated into the RNA-induced silencing complex (RISC). The most well-studied outcome is post-transcriptional gene silencing, which occurs when the guide strand pairs with a complementary sequence in a messenger RNA molecule and induces cleavage by Argonaute, the catalytic component of the RISC complex. In some organisms, this process spreads systemically, despite the initially limited molar concentrations of siRNA.RNAi is a valuable research tool, both in cell culture and in living organisms, because synthetic dsRNA introduced into cells can selectively and robustly induce suppression of specific genes of interest. RNAi may be used for large-scale screens that systematically shut down each gene in the cell, which can help to identify the components necessary for a particular cellular process or an event such as cell division. The pathway is also used as a practical tool in biotechnology, medicine and insecticides.