• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
RNA Interference of Signal Peptide-binding Protein SRP54 Elicits
RNA Interference of Signal Peptide-binding Protein SRP54 Elicits

Akt blocks ligand binding and protects against expanded
Akt blocks ligand binding and protects against expanded

... for androgen. We measured the ability of the aspartatesubstituted AR to bind to 3[H]-R1881, a non-metabolizable AR agonist (Fig. 5A, see Materials and Methods). We found significantly less labeled R1881 bound to the double aspartatesubstituted receptors than to non-substituted AR65Q. Substitution of ...
Light and electron microscopic studies on turbot Psetta maxima
Light and electron microscopic studies on turbot Psetta maxima

... sometimes accompanied by loss of their content, when compared to turbot with slight infections. The inflammatory reaction present in the lamina propria–submucosa was scarce or moderate, but it usually occurred in those folds where the number of parasites was high. In these cases, mild dilation of su ...
Multiple Inducers of the Drosophila Heat Shock Locus 93D (hsro
Multiple Inducers of the Drosophila Heat Shock Locus 93D (hsro

... of hsps can also be found in nonstressed cells (at least in some cell types), encoded by transcripts of either the gene used in heat shock or by a closely related gene. The roles of these proteins in heat shock may not be fundamentally different from their roles in nonstressed cells. The mRNAs for h ...
3.2 Cell Organelles KEY CONCEPT  Eukaryotic cells share many similarities.
3.2 Cell Organelles KEY CONCEPT Eukaryotic cells share many similarities.

... • Many processes occur in the endoplasmic reticulum. • There are two types of endoplasmic reticulum. – rough endoplasmic reticulum – smooth endoplasmic reticulum ...
3.2 Cell Organelles Several organelles are involved in making and
3.2 Cell Organelles Several organelles are involved in making and

... • Many processes occur in the endoplasmic reticulum. • There are two types of endoplasmic reticulum. – rough endoplasmic reticulum – smooth endoplasmic reticulum ...
Comparison of Plant Cell Wall to Buildings Engineered to Survive
Comparison of Plant Cell Wall to Buildings Engineered to Survive

... cell wall goes through in its life time will determine the final shape of the plant itself (Alberts 2009)f. A cell wall constantly be under from pressure on two sides. Being part of a living organism means that that there is compression from the plant holding it’s self together. At the same time tur ...
Evolvement of LEM proteins as chromatin tethers at the nuclear
Evolvement of LEM proteins as chromatin tethers at the nuclear

... preferential tethering of intergenic regions with repressive histone marks at the NE [19]. This led to the concept that LADs (lamina-associated domains), whose molecular properties remain elusive, mediate anchoring of genomic regions to the periphery and keep genes in a transcriptionally ‘locked’ st ...
Lyt-23+ CYCLOPHOSPHAMIDE-SENSITIVE T CELLS REGULATE
Lyt-23+ CYCLOPHOSPHAMIDE-SENSITIVE T CELLS REGULATE

... where Ve is the elution volume for the protein, Vo is the column void volume determined from the elution volume of blue dextran 2000 . Using semi-logarithmic graph paper, the Ka~ value for each protein was plotted (linear scale) against the corresponding molecular weight (logarithmic scale) . 1 ml o ...
Associative learning increases adult neurogenesis during a critical
Associative learning increases adult neurogenesis during a critical

... Learning increases the number of immature neurons that survive and mature in the adult hippocampus. One-week-old cells are more likely to survive in response to learning than cells in animals that are exposed to training but do not learn. Because neurogenesis is an ongoing and overlapping process, i ...
Regulation of multiple target genes by miR-1 and miR
Regulation of multiple target genes by miR-1 and miR

Protists
Protists

... Protists – “Kingdom Protista” – Domain Eukarya The word kingdom is controversial – some scientists have abandoned the kingdom protista and still use the category protist for organisms that do not fit the kingdoms Plants, Fungi, or Animals Algaelike – plant like ...
Biology
Biology

... cells. Give an example of another specialised cell in humans and another specialised cell in plants. (2 marks) In humans: _________________ In plants: __________________ d) Both the liver cells and palisade mesophyll cells are eukaryotic cells. What does this mean? (2 marks) ________________________ ...
Bone Pain Is Mediated by TRPV4 via Aquaporin
Bone Pain Is Mediated by TRPV4 via Aquaporin

... Senior author whiroki@clin.medic.mie-u.ac.jp ...
Cell Behaviour 2 - Cell Shape and Movement Anil Chopra Describe
Cell Behaviour 2 - Cell Shape and Movement Anil Chopra Describe

... peripheral nerve fibers. ...
7-1 Life Is Cellular
7-1 Life Is Cellular

... Eukaryotes are cells that contain a nucleus. Prokaryotes are cells that do not contain a nucleus. The nucleus is the structure that contains the cell's DNA and controls many of the cell's activities. ...
Yantar, a conserved arginine-rich protein is involved in Drosophila
Yantar, a conserved arginine-rich protein is involved in Drosophila

... inverse PCR (http://www.fruitfly.org/about/methods/ inverse.pcr.html). The forward primer, P[GalW] GCGTCGGTTTAGAGCAGCAGAGCTT, and reverse primer, Plac1 CACCCAAGGCTC-TGCTCCCACAAT, were used to amplify an approximately 850-bp fragment. Additional ytr alleles (DP22, DP2) were isolated by imprecise exci ...
PC7 and the related proteases Furin and Pace4 regulate E
PC7 and the related proteases Furin and Pace4 regulate E

... to either assume an outer fate or quickly return to ICM, and some cells on the outside sink inside as late as during cavitation (Fleming, 1987; Yamanaka et al., 2010; McDole et al., 2011). Only the most surface-exposed mother cells in transition to the 16-cell stage give rise exclusively to outer ce ...
Induction of Sequence-Specific DNA
Induction of Sequence-Specific DNA

... proteins reacted with them. In HCD-57 cells infected with Friend spleen focus-forming virus, which now grow in an Epo-independentmanner, the DNA-bindingfactors were constitutively activated even in the absence of Epo. These results suggestthat thefactors induced by Epo contain components identicalor ...
1 - Biology D118
1 - Biology D118

... Osmosis: The diffusion of water across a cell membrane is called osmosis. Water molecules move into or out of a cell by osmosis. In osmosis, water molecules diffuse across the cell membrane until they are in equal concentration on both sides. The misting of produce in a supermarket is an attempt to ...
Unicellular Organisms
Unicellular Organisms

... People use yeast, one kind of unicellular organism, to make bread and beer. Others help us by eating harmful bacteria and are food for fish and other animals. At least one kind of unicellular organism can cause illness in people. Amoebic dysentery, whose main symptom is bloody diarrhea, is transmitt ...
Confocal imaging of glial cells in the intact rat optic nerve
Confocal imaging of glial cells in the intact rat optic nerve

Inner nuclear membrane protein transport is mediated by multiple
Inner nuclear membrane protein transport is mediated by multiple

... reassembly at the end of mitosis, they were depleted from vesiculated Xenopus oocyte extracts that were then mixed with demembraned sperm chromatin. Undepleted extracts reformed NEs, while those depleted for p97 did not [31]. The nuclei formed in this assay system can recapitulate many characteristi ...
The Size of It All
The Size of It All

... treated so that they are fluorescent. The antibodies are then applied to the specimen, if the antigens are present the specimen will appear to fluoresce. ...
7. Biology Glossary
7. Biology Glossary

... one-celled organisms that form phytoplankton as well as the seaweeds. Although algae photosynthesise and their cells are surrounded by a cell wall, they are not plants. They belong to a group of organisms called the Protoctista. Allele: One of the different forms of a particular gene.In humans, a ge ...
< 1 ... 333 334 335 336 337 338 339 340 341 ... 1231 >

Amitosis

Amitosis (a- + mitosis) is absence of mitosis, the usual form of cell division in the cells of eukaryotes. There are several senses in which eukaryotic cells can be amitotic. One refers to capability for non-mitotic division and the other refers to lack of capability for division. In one sense of the word, which is now mostly obsolete, amitosis is cell division in eukaryotic cells that happens without the usual features of mitosis as seen on microscopy, namely, without nuclear envelope breakdown and without formation of mitotic spindle and condensed chromosomes as far as microscopy can detect. However, most examples of cell division formerly thought to belong to this supposedly ""non-mitotic"" class, such as the division of unicellular eukaryotes, are today recognized as belonging to a class of mitosis called closed mitosis. A spectrum of mitotic activity can be categorized as open, semi-closed, and closed mitosis, depending on the fate of the nuclear envelope. An exception is the division of ciliate macronucleus, which is not mitotic, and the reference to this process as amitosis may be the only legitimate use of the ""non-mitotic division"" sense of the term today. In animals and plants which normally have open mitosis, the microscopic picture described in the 19th century as amitosis most likely corresponded to apoptosis, a process of programmed cell death associated with fragmentation of the nucleus and cytoplasm. Relatedly, even in the late 19th century cytologists mentioned that in larger life forms, amitosis is a ""forerunner of degeneration"".Another sense of amitotic refers to cells of certain tissues that are usually no longer capable of mitosis once the organism has matured into adulthood. In humans this is true of various muscle and nerve tissue types; if the existing ones are damaged, they cannot be replaced with new ones of equal capability. For example, cardiac muscle destroyed by heart attack and nerves destroyed by piercing trauma usually cannot regenerate. In contrast, skin cells are capable of mitosis throughout adulthood; old skin cells that die and slough off are replaced with new ones. Human liver tissue also has a sort of dormant regenerative ability; it is usually not needed or expressed but can be elicited if needed.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report