• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
biology final study guide spring 2011 - 12
biology final study guide spring 2011 - 12

... 78. Within a decade of the introduction of a new insecticide, nearly all of the descendants of the target insects are resistant to the usual-sized dose. What is the most likely explanation for this change in susceptibility to the insecticide? 79. Which event during meiosis leads to a reduction in c ...
Hybrid Zone - Madeira City Schools
Hybrid Zone - Madeira City Schools

... D. Hybrid Zones cause reproductive isolation 1. A Hybrid Zone is a region in which members of different species meet and mate, producing at least some offspring of mixed ancestry. a. Narrow band pattern  there is an obstacle to gene flow obstacle is probably that hybrids have increased rates of e ...
Document
Document

... FERTILIZATION ...
Standard Biology Chapter 27 Human Genetics
Standard Biology Chapter 27 Human Genetics

... Can happen if baby has more than 46 chromosomes Can happen if baby has less than 46 chromosomes Can happen if sperm or egg have more or less than 23 chromosomes ...
2n = 47
2n = 47

... Chromosome Number  All cells in the human body ...
File
File

... _____ 2. What statement about crossing-over is true? a. The genetic variability of the off spring is reduced. b. It occurs during meiosis. c. Genes located far apart on a chromosome are less likely to be separated. ...
Guide to 2nd Drosophila discussion
Guide to 2nd Drosophila discussion

... Paper for discussion: Hartl TA, Smith HF, Bosco G. (2008) Chromosome alignment and transvection are antagonized by condensin II. Science 322(5906):1384-7 Although this paper is not heavy on genetic techniques, it will expose you to some interesting aspects of biology with very strong Drosophila gene ...
Name - Humble ISD
Name - Humble ISD

... each cell are called _autosomes_______. The 23rd pair of chromosomes are the _sex___ chromosomes. In female somatic cells, the sex chromosomes are _XX___; in a male’s cells, the sex chromosomes are _XY___. B. Human Gametes Gametes are _haploid___, or _n__, and contain _23___ chromosomes. Female game ...
Introduction BOR 07 PV
Introduction BOR 07 PV

... • requires shedding of eggs and sperm • usually in moist environment – prevent egg desiccation – allow sperm transport ...
4th Quarter Review
4th Quarter Review

... Chart used to look at a family’s genetic traits Graph used to look at DNA Sequencing of gene. ...
Mitosis in Onion Root Tip Cells Lab
Mitosis in Onion Root Tip Cells Lab

... A quick overview of cell division The genetic information of plants, animals and other eukaryotic organisms resides in several (or many) individual DNA molecules, or chromosomes. For example, each human cell possesses 46 chromosomes, while each cell of an onion possesses 8 chromosomes. All cells mus ...
Meiosis
Meiosis

... In some organisms, such as the hexaploid wheat and Drosophila, the pairing of homologous chromosomes occurs prior to meiosis. However, in many other organisms such as maize, oat, humans, and mice, homologous chromosomes are not associated with each other until zygotene. Regardless of when chromosome ...
Single Genes With Multiple Alleles The Sex Chromosomes Traits
Single Genes With Multiple Alleles The Sex Chromosomes Traits

... Even though a gene may have multiple alleles, a person can carry only two of those alleles Because chromosomes exist in pairs carrying only one allele for each gene ...
Sex Inheritance and linkage
Sex Inheritance and linkage

... XXY syndrome ...
Biology Fall Semester Study Guide
Biology Fall Semester Study Guide

... 1.) Draw and label the stages of mitosis in the correct order. 2.) Why is mitosis important for multicellular organisms? 3.) If plants reproduce via vegetative propagation, will the offspring be genetically identical to the parent plant or genetically unique? 4.) List the advantages of asexual repro ...
Chromosome Tutorial
Chromosome Tutorial

... mother. Chromosomes that are homologous are almost always the same size, have their centromeres in the same position and carry the same number and type of genes. (An exception to this rule will be described later in the tutorial.) Homologous chromosomes are not identical because the DNA sequence of ...
aeiab Meiosis
aeiab Meiosis

... frequency of crossing over, and for demonstrating the random assortment of the chromosomes to the daughter nuclei during meiosis I. In certain fungi such as the pink bread mold, Neurospora crassa, and Sordaria fimicola (the organism you will study during this lab), meiosis occurs within a structure ...
ABO Blood Types
ABO Blood Types

... same chromosome are more likely to be inherited together • Crossing over helps to increased variation, but the closer two genes are on a chromosome the more likely they are to be “linked” • The frequency of crossing over between two genes can be used to estimate the relative positions of genes on ch ...
Classical Papers
Classical Papers

... • Fertilization of ovum (11) and sperm (11) restores diploid number of 22 ...
Human Heredity
Human Heredity

... The female is a sex linked carrier for “red glowing nose”…but her phenotype is black nose….and she is ...
Supplementary information (doc 11K)
Supplementary information (doc 11K)

... in these crosses produced the high frequency of inviable progeny (due to ...
tggccatcgtaaggtgcgacc ggtagca
tggccatcgtaaggtgcgacc ggtagca

... 2. In the space below, come up with your own metaphor to show the relationship between DNA, genes, and chromosomes. Draw a picture in the space below. Underneath each picture, give a brief description of how your picture represents the concept. ...
Biology Fall Semester Study Guide
Biology Fall Semester Study Guide

... What are the first and last things to do before entering and leaving the lab area? Give 3 examples example of how humans maintain homeostasis. Explain the difference between independent and dependent variables. What is meant by a controlled experiment? Why is it important to only test one variable a ...
Handout
Handout

... Types of Mutations Some mutations affect a single gene, while others affect an entire chromosome. A __________________________________ affects a single gene.  Many kinds of mutations can occur, especially during replication. Types of Gene Mutations:  A ________________________________________ subs ...
Chapter 08 Lecture Outline 8.1 Microscopic Examination of
Chapter 08 Lecture Outline 8.1 Microscopic Examination of

... •  In many instances, polyploid strains of plants display outstanding agricultural characteristics –  They are often larger in size and more robust ...
< 1 ... 197 198 199 200 201 202 203 204 205 ... 336 >

Ploidy



Ploidy is the number of sets of chromosomes in a cell. Usually a gamete (sperm or egg, which fuse into a single cell during the fertilization phase of sexual reproduction) carries a full set of chromosomes that includes a single copy of each chromosome, as aneuploidy generally leads to severe genetic disease in the offspring. The gametic or haploid number (n) is the number of chromosomes in a gamete. Two gametes form a diploid zygote with twice this number (2n, the zygotic or diploid number) i.e. two copies of autosomal chromosomes. For humans, a diploid species, n = 23. A typical human somatic cell contains 46 chromosomes: 2 complete haploid sets, which make up 23 homologous chromosome pairs.Because chromosome number is generally reduced only by the specialized process of meiosis, the somatic cells of the body inherit and maintain the chromosome number of the zygote. However, in many situations somatic cells double their copy number by means of endoreduplication as an aspect of cellular differentiation. For example, the hearts of two-year-old children contain 85% diploid and 15% tetraploid nuclei, but by 12 years of age the proportions become approximately equal, and adults examined contained 27% diploid, 71% tetraploid and 2% octaploid nuclei.Cells are described according to the number of sets present (the ploidy level): monoploid (1 set), diploid (2 sets), triploid (3 sets), tetraploid (4 sets), pentaploid (5 sets), hexaploid (6 sets), heptaploid or septaploid (7 sets), etc. The generic term polyploid is frequently used to describe cells with three or more sets of chromosomes (triploid or higher ploidy).
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report