Identification of alternative spliced mRNA variants related to(1).
... A total of 4322 reference sequences were screened and 3490(81%) reference sequences were predicted as alternative spliced ,producing 26,812 splicing variants. On average six splicing variants were observed for each reference sequences. 87% variants contained less then 16 EST ,and 58% were repres ...
... A total of 4322 reference sequences were screened and 3490(81%) reference sequences were predicted as alternative spliced ,producing 26,812 splicing variants. On average six splicing variants were observed for each reference sequences. 87% variants contained less then 16 EST ,and 58% were repres ...
Transcriptome analysis reveals unique C4
... oil, animal tissues and fungi [8]. Interest in ArA and other long-chain PUFAs inspired the search for new PUFA sources. Myrmecia incisa Reisigl H4301, a coccoid green microalga species of Trebouxiophyceae [9], has recently been reported to accumulate an unprecedentedly high amount of ArA-rich triacy ...
... oil, animal tissues and fungi [8]. Interest in ArA and other long-chain PUFAs inspired the search for new PUFA sources. Myrmecia incisa Reisigl H4301, a coccoid green microalga species of Trebouxiophyceae [9], has recently been reported to accumulate an unprecedentedly high amount of ArA-rich triacy ...
1_Introduction and Importance
... human health more than any other medical advance, but we are on the verge of using plants as sophisticated chemical factories to produce all manner of materials useful to medicine and industry. We are beginning to understand the structure and function of an increasing number of enzymes and other pro ...
... human health more than any other medical advance, but we are on the verge of using plants as sophisticated chemical factories to produce all manner of materials useful to medicine and industry. We are beginning to understand the structure and function of an increasing number of enzymes and other pro ...
Supplementary Figures (doc 9746K)
... categories are junctions whose start and stop sites have been annotated in the Ensembl gene annotation. The only difference is that the new junction group uses different combinations of start and stop sites. The 3rd and 4th categories are junctions having new 3’ stop sites (acceptor site) or 5’ star ...
... categories are junctions whose start and stop sites have been annotated in the Ensembl gene annotation. The only difference is that the new junction group uses different combinations of start and stop sites. The 3rd and 4th categories are junctions having new 3’ stop sites (acceptor site) or 5’ star ...
Conflicting Phylogenies for Early Land Plants are Caused by
... mosses and hornworts it will make the mossesplus-liverworts as the earliest-diverging lineages sister to the remaining land plants, whereas if it is placed on one of the branches leading to any of the three bryophyte groups then that group alone will form the earliest-diverging lineage. The observat ...
... mosses and hornworts it will make the mossesplus-liverworts as the earliest-diverging lineages sister to the remaining land plants, whereas if it is placed on one of the branches leading to any of the three bryophyte groups then that group alone will form the earliest-diverging lineage. The observat ...
DNACatalyzed Lysine Side Chain Modification
... 9DT105 and the six 14DV1 deoxyribozymes were each Lys reactivity has never been observed previously with assayed with the free (non-DNA-anchored) CKA tripeptide either DNA or RNA enzymes, including in our previous at up to 1 mm concentration. The unattached DNA anchor studies that successfully led t ...
... 9DT105 and the six 14DV1 deoxyribozymes were each Lys reactivity has never been observed previously with assayed with the free (non-DNA-anchored) CKA tripeptide either DNA or RNA enzymes, including in our previous at up to 1 mm concentration. The unattached DNA anchor studies that successfully led t ...
Defining the Epigenetic Mechanism of Asymmetric Cell Division of
... named) Watson strand-containing chromatid is switching competent, and its sister cell, inheriting the template Crick strand-containing chromatid, is always incompetent (Klar 1987a, 1990, 2007). The difference in strands is the result of the DNA sequence- and strand-specific imprint moiety installed a ...
... named) Watson strand-containing chromatid is switching competent, and its sister cell, inheriting the template Crick strand-containing chromatid, is always incompetent (Klar 1987a, 1990, 2007). The difference in strands is the result of the DNA sequence- and strand-specific imprint moiety installed a ...
chapter 3 transmission genetics – chromosomes, recombination and
... are two sets of chromosomes, known as homologous pairs. At the time of fertilization, one set of homologues is contributed by the egg gamete (1N) and the other set by the pollen gamete (1N). The union of these two gametes forms the diploid zygote. This single-celled zygote then undergoes cell divisi ...
... are two sets of chromosomes, known as homologous pairs. At the time of fertilization, one set of homologues is contributed by the egg gamete (1N) and the other set by the pollen gamete (1N). The union of these two gametes forms the diploid zygote. This single-celled zygote then undergoes cell divisi ...
A Novel Knowledge Based Method to Predicting Transcription
... ‘N’ suffixes, e.g. ‘CCCCACGTAGCTAGACGTAG’ will be extended to ‘CCCCACGTAGCTAGACGTAGNNNNN’, meanwhile make no change for these TFBSs with length exact 25bp. Then, these TFBSs can be represented in a 100D (Dimensional) vector, e.g. ‘ACGTAGCTAGACGTAGCTAGNNNNN’ will be represented in a 100D binary vecto ...
... ‘N’ suffixes, e.g. ‘CCCCACGTAGCTAGACGTAG’ will be extended to ‘CCCCACGTAGCTAGACGTAGNNNNN’, meanwhile make no change for these TFBSs with length exact 25bp. Then, these TFBSs can be represented in a 100D (Dimensional) vector, e.g. ‘ACGTAGCTAGACGTAGCTAGNNNNN’ will be represented in a 100D binary vecto ...
Dow, Graham: The limitation of genome wide association studies
... genome. From an evolutionary perspective, the lack of strong, common variants in expressed genes makes sense; one should expect that such variants be selected against in the population. The area surrounding an intergenic SNP can be quite large depending on the number of SNPs used ...
... genome. From an evolutionary perspective, the lack of strong, common variants in expressed genes makes sense; one should expect that such variants be selected against in the population. The area surrounding an intergenic SNP can be quite large depending on the number of SNPs used ...
Genetics and Pedigrees Bio I
... Genetics-the study of inheritance or heredity Inheritance- the passing on of traits from one generation to the next Trait/Characteristic- any factor used to describe or distinguish ...
... Genetics-the study of inheritance or heredity Inheritance- the passing on of traits from one generation to the next Trait/Characteristic- any factor used to describe or distinguish ...
Microsporidia: Why Make Nucleotides if You Can Steal Them?
... triphosphates following nucleic acid degradation have been retained by microsporidia [4] and include dedicated monophosphate kinases and the broad-spectrum nucleoside diphosphate kinase (NDK/YNK in yeast) (Fig 1) [4,18]. While nucleoside triphosphate regeneration involves some energy-expensive steps ...
... triphosphates following nucleic acid degradation have been retained by microsporidia [4] and include dedicated monophosphate kinases and the broad-spectrum nucleoside diphosphate kinase (NDK/YNK in yeast) (Fig 1) [4,18]. While nucleoside triphosphate regeneration involves some energy-expensive steps ...
The Evolutionary Accessibility of New Enzyme Functions: A Case
... distribution and reuse in derivative works provided the original author(s) and source are credited. Notes: A Critique of this paper, when available, will be assigned doi:10.5048/BIO-C.2011.1.c. * Email: daxe@biologicinstitute.org ...
... distribution and reuse in derivative works provided the original author(s) and source are credited. Notes: A Critique of this paper, when available, will be assigned doi:10.5048/BIO-C.2011.1.c. * Email: daxe@biologicinstitute.org ...
Exploring Important Biological Concepts Using Biology Workbench
... Genetic Code: Missense mutations may result in a chemically similar amino acid being inserted at that position in an amino acid chain. Mutations that result in the substitution of one amino acid for another are termed missense mutations. Due to the relationship among codons in the genetic code, many ...
... Genetic Code: Missense mutations may result in a chemically similar amino acid being inserted at that position in an amino acid chain. Mutations that result in the substitution of one amino acid for another are termed missense mutations. Due to the relationship among codons in the genetic code, many ...
Cancer, Genes, Inheritance Pattern, Germ Cell Mutation
... we all have. A change in the information in a ‘cancer protection’ gene that makes the gene faulty is called a mutation • The cause of the changes that make the ‘cancer protection’ gene faulty is unknown, but may be due to a combination of genetic factors, environmental factors, and the process of a ...
... we all have. A change in the information in a ‘cancer protection’ gene that makes the gene faulty is called a mutation • The cause of the changes that make the ‘cancer protection’ gene faulty is unknown, but may be due to a combination of genetic factors, environmental factors, and the process of a ...
This article appeared in a journal published by Elsevier. The
... in suppressor activity of SD2b and Q2b was due to different expression levels of the 2b proteins by having conducted another set of experiments in which the SD2b gene and the Q2b gene were each 30 -tagged with the same triple HA sequence and the Agrobacterium strain harboring p35S-SD2b-3HA or p35S-Q ...
... in suppressor activity of SD2b and Q2b was due to different expression levels of the 2b proteins by having conducted another set of experiments in which the SD2b gene and the Q2b gene were each 30 -tagged with the same triple HA sequence and the Agrobacterium strain harboring p35S-SD2b-3HA or p35S-Q ...
Development and characterization of DehaloR^2, a novel anaerobic
... reagent concentrations, and thermocycler conditions for bacteria were described in Ritalahti et al. (2006), in Cummings et al. (2003) for Geobacteraceae, and in Holmes et al. (2006) for Dehalococcoides. For the reductive dehalogenase genes, we used a triplicate assay described in Lee et al. (2008). ...
... reagent concentrations, and thermocycler conditions for bacteria were described in Ritalahti et al. (2006), in Cummings et al. (2003) for Geobacteraceae, and in Holmes et al. (2006) for Dehalococcoides. For the reductive dehalogenase genes, we used a triplicate assay described in Lee et al. (2008). ...
Plants` Epigenetic Secrets
... Although CHG methylation is symmetrical and thus could in principle use the same methylation maintenance pathway as CG methylation, it also relies on RNA-directed DNA methylation (not pictured below). In addition, this type of methylation is paired with methylation of lysine 9 on histone H3 (H3K9). ...
... Although CHG methylation is symmetrical and thus could in principle use the same methylation maintenance pathway as CG methylation, it also relies on RNA-directed DNA methylation (not pictured below). In addition, this type of methylation is paired with methylation of lysine 9 on histone H3 (H3K9). ...
The Metabolic Network of Synechocystis sp. PCC
... modeling, most notably flux-balance analysis (FBA), has become a quasi-standard in the field. FBA is increasingly utilized to elucidate and characterize largescale network properties, to direct the discovery of novel or alternative pathways, to guide metabolic engineering, as well as for the concept ...
... modeling, most notably flux-balance analysis (FBA), has become a quasi-standard in the field. FBA is increasingly utilized to elucidate and characterize largescale network properties, to direct the discovery of novel or alternative pathways, to guide metabolic engineering, as well as for the concept ...
GST II: ---Title--- - Digital Biology Laboratory
... Need for Heuristic Alignment Time complexity for optimal alignment: O(n2) , n -- sequence length Given the current size of sequence databases, use of optimal algorithms is not practical for database search Heuristic techniques: BLAST, FASTA, MUMmer, PatternHunter... 20 min (optimal alignment, S ...
... Need for Heuristic Alignment Time complexity for optimal alignment: O(n2) , n -- sequence length Given the current size of sequence databases, use of optimal algorithms is not practical for database search Heuristic techniques: BLAST, FASTA, MUMmer, PatternHunter... 20 min (optimal alignment, S ...
Breeding Policy for the RagaMuffin Cat
... Only offspring resulting from a RagaMuffin to RagaMuffin mating are eligible for registration on the full or supplementary registers as RagaMuffins. Breeders should try to breed RagaMuffins that adhere closely to the original type as described in the Standard of Points. The RagaMuffin Breed Advisory ...
... Only offspring resulting from a RagaMuffin to RagaMuffin mating are eligible for registration on the full or supplementary registers as RagaMuffins. Breeders should try to breed RagaMuffins that adhere closely to the original type as described in the Standard of Points. The RagaMuffin Breed Advisory ...
Interaction of nonsense suppressor tRNAs and codon nonsense
... response to a termination codon. Because termination codons consists of three types (TAG, TAA and TGA), nonsense mutations are divided into amber, ochre, or opal mutations (resulting in UAG, UAA or UGA). Therefore, nonsense suppressors include three kinds of amber, ochre or opal suppressor [1,2]. Th ...
... response to a termination codon. Because termination codons consists of three types (TAG, TAA and TGA), nonsense mutations are divided into amber, ochre, or opal mutations (resulting in UAG, UAA or UGA). Therefore, nonsense suppressors include three kinds of amber, ochre or opal suppressor [1,2]. Th ...