Statistical Analysis of Amino Acid Patterns in Transmembrane
... To ®nd motifs that mediate helix-helix interactions in membrane proteins, we have analyzed frequently occurring combinations of residues in a database of transmembrane domains. Our analysis was performed with a novel formalism, which we call TMSTAT, for exactly calculating the expectancies of all pa ...
... To ®nd motifs that mediate helix-helix interactions in membrane proteins, we have analyzed frequently occurring combinations of residues in a database of transmembrane domains. Our analysis was performed with a novel formalism, which we call TMSTAT, for exactly calculating the expectancies of all pa ...
Solid Tumour Section Kidney: Nephroblastoma (Wilms tumor) Atlas of Genetics and Cytogenetics
... Note: Other chromosomal regions involved are: - 11p15 : BWS, an overgrowth syndrome, is caused by alterations of 11p15, a region subject to genomic imprinting: loss of of imprinting of IGF2 is the most common defect found; WT1 is rarely implicated solely in sporadic Wilms tumours, but maternal allel ...
... Note: Other chromosomal regions involved are: - 11p15 : BWS, an overgrowth syndrome, is caused by alterations of 11p15, a region subject to genomic imprinting: loss of of imprinting of IGF2 is the most common defect found; WT1 is rarely implicated solely in sporadic Wilms tumours, but maternal allel ...
... were isolated with a tightly linked RAPD marker, and subsequently the regions flanking the Rps1 locus were nearly saturated with AFLP markers. Identification and mapping of RAPD markers linked to the Rps1 locus. The screening of 400 decamer primers against the cultivar Williams (rps1-k) and its NIL ...
Germinated lupine, Alkaloids, Stachyose, Raffinose, Availability of
... detriment in traditional food intake; this is leading to a state of protein-calorie malnutrition, with deteriorating health and increased morbidity and mortality from chronic diseases [2]. The increase in production and consumption of lupine, can help change this situation, through the offering of a ...
... detriment in traditional food intake; this is leading to a state of protein-calorie malnutrition, with deteriorating health and increased morbidity and mortality from chronic diseases [2]. The increase in production and consumption of lupine, can help change this situation, through the offering of a ...
Benchmarking two commonly used Saccharomyces
... more than 50% of the analyzes with CEN.PK series being the most popular (approx. 37%-CEN.PK vs. 24%-S288c and its derivatives) (Kim et al., 2012; Hong and Nielsen, 2012). The importance of the two strains as cell factories is further substantiated by an extensive multi-laboratory efforts which were ...
... more than 50% of the analyzes with CEN.PK series being the most popular (approx. 37%-CEN.PK vs. 24%-S288c and its derivatives) (Kim et al., 2012; Hong and Nielsen, 2012). The importance of the two strains as cell factories is further substantiated by an extensive multi-laboratory efforts which were ...
tRNA
... a specific amino acid (aa) for which it harbors an anticodon generates the corresponding aminoacyl-tRNA (aa-tRNA) conjugate in a process referred to as “aminoacylation” - How should the tRNA attached to the following amino acids be nomenclatured (or named)? Arg, Glu, and Trp - On the other hand, tRN ...
... a specific amino acid (aa) for which it harbors an anticodon generates the corresponding aminoacyl-tRNA (aa-tRNA) conjugate in a process referred to as “aminoacylation” - How should the tRNA attached to the following amino acids be nomenclatured (or named)? Arg, Glu, and Trp - On the other hand, tRN ...
PDF Full-text
... Sedimentary organic matter plays an important role in sediment biogeochemical processes [1], and 30%–99% of organic matter deposited on the surface sediment is remineralized during early diagenesis [2]. Factors such as sediment physicochemical properties, water column depth, and redox conditions, es ...
... Sedimentary organic matter plays an important role in sediment biogeochemical processes [1], and 30%–99% of organic matter deposited on the surface sediment is remineralized during early diagenesis [2]. Factors such as sediment physicochemical properties, water column depth, and redox conditions, es ...
Defective intestinal amino acid absorption in Ace2 null mice
... characterized by neutral aminoaciduria and in some cases pellagralike symptoms. These latter symptoms caused by low-niacin are thought to result from defective intestinal absorption of its precursor L-tryptophan. Since Ace2 is necessary for intestinal B0AT1 expression, we tested the impact of intest ...
... characterized by neutral aminoaciduria and in some cases pellagralike symptoms. These latter symptoms caused by low-niacin are thought to result from defective intestinal absorption of its precursor L-tryptophan. Since Ace2 is necessary for intestinal B0AT1 expression, we tested the impact of intest ...
Towards the construction of Escherichia coli cell
... Cell-free protein systems are described as the in vitro expression of recombinant proteins without the use of living cells. This approach uses a cell lysate containing a wide array of biological and chemical components for transcription, translation, protein folding, and energy metabolism; all requi ...
... Cell-free protein systems are described as the in vitro expression of recombinant proteins without the use of living cells. This approach uses a cell lysate containing a wide array of biological and chemical components for transcription, translation, protein folding, and energy metabolism; all requi ...
Gene Duplication - Semantic Scholar
... Gene duplication typically occurs by one of three mutational mechanisms: unequal crossing-over, retroposition, and chromosomal (or genome) duplication. Zhang 2003 summarizes the main features of these mechanisms. Kaessmann, et al. 2009 provides detailed information a ...
... Gene duplication typically occurs by one of three mutational mechanisms: unequal crossing-over, retroposition, and chromosomal (or genome) duplication. Zhang 2003 summarizes the main features of these mechanisms. Kaessmann, et al. 2009 provides detailed information a ...
Evolutionary dynamics of RNA-like replicator systems
... reactions occurring in the cell. Nevertheless, RNA molecules are the actual catalyst of protein synthesis, one of the most vital reactions for life. It seems as if this role of RNA is a historical contingency. The second implication is that not only proteins, but also RNA can function as an efficien ...
... reactions occurring in the cell. Nevertheless, RNA molecules are the actual catalyst of protein synthesis, one of the most vital reactions for life. It seems as if this role of RNA is a historical contingency. The second implication is that not only proteins, but also RNA can function as an efficien ...
What is p53
... the p53 pathway (picture summarizing the cellular functions of p53, 996, by Hall PA et al.) ...
... the p53 pathway (picture summarizing the cellular functions of p53, 996, by Hall PA et al.) ...
Classification of Centers for Disease Control Group Eugonic
... group of Gram-negative saccharolytic organisms predominantly recovered from human wounds resulting from dog or cat bites. EF-4 isolates are considered to be commensal organisms found in the oral cavity of dogs and cats, although systemic infections in humans and animals have also been reported (Gani ...
... group of Gram-negative saccharolytic organisms predominantly recovered from human wounds resulting from dog or cat bites. EF-4 isolates are considered to be commensal organisms found in the oral cavity of dogs and cats, although systemic infections in humans and animals have also been reported (Gani ...
Maintenance of Membrane Integrity and Permeability Depends on a
... showed that these mutations were alleles of the same gene. After we generated a male from ys9, we mated ys9 males with ys20 hermaphrodites and tested ethanol sensitivity of F1 male heterozygotes of the genotype ys9/ys20. While N2 males and ys9 heterozygous males of the genotype ys9/+ showed paralysi ...
... showed that these mutations were alleles of the same gene. After we generated a male from ys9, we mated ys9 males with ys20 hermaphrodites and tested ethanol sensitivity of F1 male heterozygotes of the genotype ys9/ys20. While N2 males and ys9 heterozygous males of the genotype ys9/+ showed paralysi ...
Low chromosome number angiosperms
... (1975) analysed the pattern of mitotic activity in suspension culture: karyotype changes with numerical and structural alteration commonly occurs in a tissue culture enviroment. Such alterations lead the the somaclonal variation in regenerated plant or may inhibit the morphogentic potential of cells ...
... (1975) analysed the pattern of mitotic activity in suspension culture: karyotype changes with numerical and structural alteration commonly occurs in a tissue culture enviroment. Such alterations lead the the somaclonal variation in regenerated plant or may inhibit the morphogentic potential of cells ...
Experimental and Molecular Pathology
... due to an “inborn error of metabolism.” Two years later it was discovered that nu/nu mice lacked a thymus, resulting in an impaired defense against pathogenic organisms (Pantelouris, 1968) (Fig. 1). Lack of fur development and athymia are not related to each other, since thymus restoration does not ...
... due to an “inborn error of metabolism.” Two years later it was discovered that nu/nu mice lacked a thymus, resulting in an impaired defense against pathogenic organisms (Pantelouris, 1968) (Fig. 1). Lack of fur development and athymia are not related to each other, since thymus restoration does not ...
Transcriptional Attenuation
... DNA segment that encodes the 1:2 RNA hairpin (Fig. 2). RNA polymerase is released from the pause site when the ribosome approaches on the nascent transcript. Once RNA polymerase leaves the pause site, the rate at which th ribosome synthesizes the remainder of the leader peptide and releases the mRNA ...
... DNA segment that encodes the 1:2 RNA hairpin (Fig. 2). RNA polymerase is released from the pause site when the ribosome approaches on the nascent transcript. Once RNA polymerase leaves the pause site, the rate at which th ribosome synthesizes the remainder of the leader peptide and releases the mRNA ...
Characterization and Surface Properties of Amino-Acid
... terminus interacts with calcium ions in the CHA lattice. Complexities in adsorption behavior are discussed in terms of different adsorption mechanisms that may be prevalent at different pHs. ...
... terminus interacts with calcium ions in the CHA lattice. Complexities in adsorption behavior are discussed in terms of different adsorption mechanisms that may be prevalent at different pHs. ...
Distinct profiling of antimicrobial peptide families
... proteins biosynthesis processes), thereby ultimately killing the targeted microbe (Frecer et al., 2004; Peters et al., 2010; Chen et al., 2012; Fjell et al., 2012). Differences in the membrane structure of higher eukaryotes and microbes cause the later to be easily recognized and targeted (Thomas et ...
... proteins biosynthesis processes), thereby ultimately killing the targeted microbe (Frecer et al., 2004; Peters et al., 2010; Chen et al., 2012; Fjell et al., 2012). Differences in the membrane structure of higher eukaryotes and microbes cause the later to be easily recognized and targeted (Thomas et ...
The Role of Nucleoside Diphosphate Kinase in Plant Mitochondria
... organisms from bacteria to human. It was discovered that the genes nm23 and awd, which encode NDPKs are involved in tumour metastasis and Drosophila development, respectively. Thus, NDPK isoforms have been suggested to have specific regulatory functions in addition to their catalytic activity. Plant ...
... organisms from bacteria to human. It was discovered that the genes nm23 and awd, which encode NDPKs are involved in tumour metastasis and Drosophila development, respectively. Thus, NDPK isoforms have been suggested to have specific regulatory functions in addition to their catalytic activity. Plant ...
Altered Fermentative Metabolism in
... when the primers used for the reaction annealed 59 of the insertion site (Figure 3A). The low level of transcript detected 39 of the insertion site (Figure 3B) might represent read-through from the PSAD promoter, which drives expression of the AphVIII gene. These results suggest that insertion of th ...
... when the primers used for the reaction annealed 59 of the insertion site (Figure 3A). The low level of transcript detected 39 of the insertion site (Figure 3B) might represent read-through from the PSAD promoter, which drives expression of the AphVIII gene. These results suggest that insertion of th ...
Unsaturated Fatty Acids Increase Plasminogen Activator Inhibitor
... have been reported for native low density lipoprotein. It could be speculated that fatty acids derived from VLDL triglycerides are the actual mediators, resulting in an enhanced secretion of PAI-1. In the present study, we have analyzed the effects of both saturated and unsaturated fatty acids on PA ...
... have been reported for native low density lipoprotein. It could be speculated that fatty acids derived from VLDL triglycerides are the actual mediators, resulting in an enhanced secretion of PAI-1. In the present study, we have analyzed the effects of both saturated and unsaturated fatty acids on PA ...
Amino Acid Evolution
... features in organisms are helpful because they can be used to trace how species migrated over time. If two species in two different locations are similar in some way it is either because both species randomly developed the same feature or the two species at one point were one species in one location ...
... features in organisms are helpful because they can be used to trace how species migrated over time. If two species in two different locations are similar in some way it is either because both species randomly developed the same feature or the two species at one point were one species in one location ...
AP Biology Notes Outline Chapter 27 Bacteria and Archaea Concept
... Some prokaryotes stick to their substrate or to one another by means of hair-like appendages called fimbriae. The ability of some prokaryotes to withstand harsh conditions is attributed to endospores, a tough wall that forms outside the cell wall. Prokaryotes use appendages called pili that ad ...
... Some prokaryotes stick to their substrate or to one another by means of hair-like appendages called fimbriae. The ability of some prokaryotes to withstand harsh conditions is attributed to endospores, a tough wall that forms outside the cell wall. Prokaryotes use appendages called pili that ad ...
Requirement for chitin biosynthesis in epithelial tube morphogenesis. Proc. Natl. Acad. Sci. USA 102: 17014-17019. pdf
... into NotI-XhoI sites of pUAST (19). UAS-kkv was made in a similar way using the RE32455 cDNA and primers Kkv-5⬘-NotI (GCGCGGCCGCTGGGTTTAGCGAAGACAACGA) and Kkv-3⬘-XhoI (GCCTCGAGATCCATCAAATCATCAATGAT). The knkGFP genomic construct was generated by PCR of Canton-S genomic DNA using primers Knk-genomic- ...
... into NotI-XhoI sites of pUAST (19). UAS-kkv was made in a similar way using the RE32455 cDNA and primers Kkv-5⬘-NotI (GCGCGGCCGCTGGGTTTAGCGAAGACAACGA) and Kkv-3⬘-XhoI (GCCTCGAGATCCATCAAATCATCAATGAT). The knkGFP genomic construct was generated by PCR of Canton-S genomic DNA using primers Knk-genomic- ...
Point mutation
A point mutation, or single base modification, is a type of mutation that causes a single nucleotide base change, insertion, or deletion of the genetic material, DNA or RNA. The term frameshift mutation indicates the addition or deletion of a base pair. A point mutant is an individual that is affected by a point mutation.Repeat induced point mutations are recurring point mutations, discussed below.