• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Document
Document

... 2. The ribosome helps form a polypeptide bond between the amino acids. 3. The ribosome pulls the mRNA strand the length of one codon and a new tRNA binds ...
RNA 8.1 Identifying DNA as the Genetic Material
RNA 8.1 Identifying DNA as the Genetic Material

... 8.1 Identifying DNA as the Genetic Material The transcription process is similar to replication. • Transcription and replication both involve complementary (matching up) base pairing. • The two processes have different end results. – Replication copies all the DNA; transcription copies one gene gro ...
Identification of Transcription Factor Binding Sites
Identification of Transcription Factor Binding Sites

... Identifying regulatory networks by combinatorial analysis of promoter ...
PPT1
PPT1

... • Collect all known sequences that bind a certain TF. • Align all sequences (using multiple sequence alignment). • Compute the frequency of each nucleotide in each position (PSPM). • Incorporate background frequency for each nucleotide (PSSM). ...
Microarray experiment guidelines
Microarray experiment guidelines

... Capable of simultaneously measuring the expression levels for thousands of genes, microarrays provide a large quantity of information about an organism/cell/tissue – whether it be mutational studies (monitoring the effects of gene expression by knocking out/in a particular gene), conditional (monito ...
Bioinformatics (Warm Up + Cracking the Genetic Code)
Bioinformatics (Warm Up + Cracking the Genetic Code)

... 5’-end GCGGAU UUAGCUCAGUUGGGAGAGC G CCAGACUGAAGA UCUGGAGGUCCUGUGUUCGAUC CACAGA AUUCGCACCA 3’-end ...
Supplemental Data
Supplemental Data

... different macroarray membranes in two independent experiments. The Pearson correlation of signal intensities obtained from both membranes is shown. (B) Gene regulation induced by Bgh attack was compared in two independent inoculation experiments by using the barleyPGRC1 macroarray. First leaves of I ...
XistAR write up
XistAR write up

... to our understanding of X-inactivation via Xist thus far, these researchers found an additional novel piece of long non-coding RNA expressed from the inactivated X chromosome. They identified this lncRNA to be antisense of Xist, and that its expression is required for proper Xist functioning. Here, ...
Return to the RNAi world: rethinking gene expression and
Return to the RNAi world: rethinking gene expression and

... described by Gregor Mendel, for certain genetic traits of pea plants. The structure alone, as Watson and Crick noted, suggests how the genetic material can be replicated. They stated in their famously brief paper in Nature1 that, ‘It has not escaped our notice that the specific pairing we have postu ...
Infectious Bursal Disease Virus (IBDV) genesig
Infectious Bursal Disease Virus (IBDV) genesig

... The Negative Control should be completely free of any DNA/RNA. If you see this error message it means that at some point during the setup, the Negative Control has been contaminated with DNA/RNA and has given a positive signal. This contamination has invalidated the test. The Positive Control and yo ...
Proteins and Nucleic Acids (PowerPoint)
Proteins and Nucleic Acids (PowerPoint)

... linked together through sugar phosphate Bonds, and four nitrogenous bases: adenine (A), guanine (G), cytosine (C), and thymine (T) [in case of RNA uracil (U) is used instead of thymine (T) and the sugar is also different, ribose instead of deoxyribose]. ...
HUA1, a Regulator of Stamen and Carpel Identities
HUA1, a Regulator of Stamen and Carpel Identities

... (such as ag-1) show stamen-to-petal transformation in the third whorl (Bowman et al., 1989), flowers of the weak ag-4 allele contain stamens in the third whorl (Sieburth et al., 1995). Recessive hua1-1 and hua2-1 mutations alter the identity of the third whorl organs in ag-4 flowers. ag-4 hua1-1 or ...
U2Word
U2Word

... “polystop”, and polyser. III. tRNA Structure: 1. tRNAs are 54-100 nucleotide residues long, usually around 76. Much of the variation is in the 3 to 21 residue variable arm. Their secondary (20) structure is shaped like a “clover leaf” (by base pairing). Fig 32-9, 11 2. They contain many unusual base ...
Geuvadis Analysis Meeting
Geuvadis Analysis Meeting

... could be explainable by allele-specific expression ~4000 cases where DNA is homozygous and RNA not (!!!) remove FPs from computational or experimental artifacts (PCR artifacts?) ...
COAS_B1_Ch08 Nucleic acids
COAS_B1_Ch08 Nucleic acids

... DNA stands for deoxyribonucleic acid. When it was discovered, it was given the name ‘nucleic acid’ because it was mostly found in the nuclei of cells and is slightly acidic. Each nucleotide in a DNA molecule contains: a phosphate group the five-carbon sugar, deoxyribose an organic base. Figure 8.1 s ...
Transcription
Transcription

... in DNA sequencing. It is used to identify the specific DNA sequences that are bound by a particular protein. ...
Androgenic control of nucleic acid and protein synthesis in male
Androgenic control of nucleic acid and protein synthesis in male

... An ever-increasing amount of experi- comprehensive molecular theories of sex mental effort has been expended over the hormone action. last 5 years toward examining various in( 1 ) It is well established that common termediate reactions involved in ribonu- pathways exist for the biosynthesis of cleic ...
Regents Biology How does mRNA code for
Regents Biology How does mRNA code for

... When their, aa are bonded, the ribosome moves along the mRNA strand in the 5’ to 3’ direction The 2nd codon and its tRNA moves to the P site and the 3rd codon moves into the A site and is paired with its complementary tRNA, and so on AUG is the only codon that begins in the P site Released tRNA reun ...
Nucleic Acids notes
Nucleic Acids notes

... only 1 strand of DNA is used as a template (template strand) the mRNA produced is complementary to the template strand but identical to the non-template DNA strand (called the informational strand) (except U for T and sugar) mRNA is produced from the 5’ to the 3’ end like in replication purpose of m ...
nucleicacidchemistry
nucleicacidchemistry

... # base-pairs of DNA in the gene… because that’s how transcription works BUT the number of bases in the unmodified mRNA > # bases in the final mRNA that actually codes for a protein SO there needs to be a process for getting rid of the unwanted bases in the mRNA: that’s what splicing is! ...
A CRISPR-based yeast two-hybrid system for investigating
A CRISPR-based yeast two-hybrid system for investigating

... inserted a multiple-cloning site (MCS) containing five unique, commonly used restrictionenzyme cleavage sites near the 3ʹ end of the sgRNA, four nucleotides 5ʹ of the HDV ribozyme cleavage site. Because at least some of the MCS will ultimately be part of the transcribed hybrid sgRNA (de ...
File
File

... • Two very different organisms evolve a similar function or characteristic independently of one another due to similar environmental challenges, not common ancestry ...
A CRISPR-based yeast two-hybrid system for investigating
A CRISPR-based yeast two-hybrid system for investigating

... inserted a multiple-cloning site (MCS) containing five unique, commonly used restrictionenzyme cleavage sites near the 3ʹ end of the sgRNA, four nucleotides 5ʹ of the HDV ribozyme cleavage site. Because at least some of the MCS will ultimately be part of the transcribed hybrid sgRNA (de ...
ESTs to genome
ESTs to genome

... ~100bp conserved on each side 12,000 exons * 100 bp * 2 introns * 0.77= 2M bases ==>At least 2 Million bases in the human genome might be involved in alternative splicing regulation. ...
ppt for
ppt for

... cells using fluidics systems, followed by cell lysis and capture of mRNA species on the poly(dT)-coated sequencing surfaces by hybridization. Standard sequencing runs could take place on channels with a 127.5 mm2 surface area, requiring 2,750 images to be taken per cycle to image the entire channel ...
< 1 ... 13 14 15 16 17 18 19 20 21 ... 88 >

Nucleic acid tertiary structure



The tertiary structure of a nucleic acid is its precise three-dimensional structure, as defined by the atomic coordinates. RNA and DNA molecules are capable of diverse functions ranging from molecular recognition to catalysis. Such functions require a precise three-dimensional tertiary structure. While such structures are diverse and seemingly complex, they are composed of recurring, easily recognizable tertiary structure motifs that serve as molecular building blocks. Some of the most common motifs for RNA and DNA tertiary structure are described below, but this information is based on a limited number of solved structures. Many more tertiary structural motifs will be revealed as new RNA and DNA molecules are structurally characterized.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report