• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Author`s personal copy
Author`s personal copy

... reducers, including denitrifiers from environmental samples, by using nutrient rich media and anaerobic conditions with nitrogen oxides as electron acceptors [73]. Although a variety of denitrifying bacteria were isolated successfully from soil [19,21,29] these cultivation attempts generally resulted ...
A long-term demasculinization of X
A long-term demasculinization of X

... some, either relocating them to the autosomes or eliminating them from the genome entirely. We investigated the contribution of MSCI and sexual antagonism to the observed X chromosome demasculinization for incRNAs in Drosophila. It is not trivial to separate the effects of sexual antagonism and MSCI ...
Evidence That the Human X Chromosome Is Enriched for Male
Evidence That the Human X Chromosome Is Enriched for Male

... a female-benefit /male-detriment allele might spread, were it X linked, and hence is a force leading to enrichment on the X chromosome of female-specific genes (after a modifier has suppressed the genes’ expression in males). However, this force will be counterbalanced by the greater relative ease o ...
A rough guide to Drosophila mating schemes (light version 2.1) 1
A rough guide to Drosophila mating schemes (light version 2.1) 1

... Daily life in a fly laboratory requires performing classical genetic crosses. In these crosses, flies are used that carry gene mutations, chromosomal aberrations or transgenic constructs. These different fly variants are the bread-and-butter of fly research, providing the tools by which genes are ma ...
Sequences of Primate Insulin Genes Support
Sequences of Primate Insulin Genes Support

... Sequences of Chimpanzee and African Green Monkey Insulin Genes The human insulin gene hybridizes to a single EcoRI fragment in many primate species whose size is about 12- 13 kb ( S. Seino and G. I. Bell, unpublished observations). EcoRI fragments containing the chimpanzee and African green monkey i ...
PART II Introducció 53
PART II Introducció 53

... segon reordenament més comú que afecta el cromosoma 15 i dóna lloc a un cromosoma 15 extranumerari (Blennow et al., 1995; Huang et al., 1997). S’han identificat duplicacions proximals de 15q en casos d’autisme i individus amb graus variables de retard mental (Cook et al., 1997). A la regió més prox ...
Figure 1 - York College of Pennsylvania
Figure 1 - York College of Pennsylvania

... CTTCCAGCAATGTCACAATAT Size: 419 base pairs ...
Bio 125 Lab Week 9: Relating Changes in Form to Changes in Genes
Bio 125 Lab Week 9: Relating Changes in Form to Changes in Genes

... protein sequence by selecting the sequence on the Nucleic Tools page and clicking on the “SIXFRAME” button. This will return all the possible protein sequences based on this DNA sequence (why are there 6?). Each amino acid is represented by a single letter, standard abbreviation (see box below). The ...
Patterns of Segmental Duplication in the Human Genome
Patterns of Segmental Duplication in the Human Genome

... divided into 500-kb segments and Blasting was performed on all-against-all segments using the default parameters. In this study, we were interested in examining duplications with size  1 kb and sequence similarity  90%; we did not consider older duplications, because they are more difficult to def ...
SEARCH_16S: A new algorithm for identifying 16S
SEARCH_16S: A new algorithm for identifying 16S

... To test the sensitivity of SEARCH_16S I used all finished prokaryotic genomes in Genbank and three large curated databases containing small subunit (SSU) ribosomal sequences: SILVA (Pruesse et al., 2007) v23, RDP (Maidak et al., 2001) downloaded 30th Sept. 2016 and Greengenes v13.5. I identified the ...
as a PDF
as a PDF

... factor to recognize UAA efficiently (Klobutcher and Farabaugh, 2002). Future work will determine if these ⫹1 frameshifting events have any regulatory function and whether other mRNA elements are involved. Two other examples of ⫹ 1 frameshifting in eukaryotes warrant mention. The ABP140 gene of S. ce ...
- SciTech Connect
- SciTech Connect

... retained in the somatic macronuleus.25,35 Instead of marking specific sequences for elimination in the macronucleus, sequences are marked for retention. In Oxytricha, 27nt RNAs of the piRNA class are generated in the somatic macronucleus from long piRNA precursor transcripts.36 These piRNAs are boun ...
CpG Mutation Rates in the Human Genome Are
CpG Mutation Rates in the Human Genome Are

... We chose to discard repetitive sequences because it would be more difficult operationally to establish their orthology with the same level of confidence. Designing such a computer program would require not only performing an additional series of sequence comparisons to establish the sequence context ...
Table S3. Transcription factor binding sites identified in haplotypes
Table S3. Transcription factor binding sites identified in haplotypes

... (Drosophila’s homolog of mammalian T Cell Factor), can therefore not be ruled out as possible regulator of ftz. This sequence, AACTGA, seems to be a 3´ binding site for a mammalian interferon regulatory factor [76]. It seems significant that our ftz cis-regulatory sequences contain multiple AACTGA c ...
Example - Hivebench
Example - Hivebench

... finding a given 4-base sequence. Thus, a sixteen base sequence will statistically be present only once in every 416 bases (=4 294 967 296 or 4 billion): this is about the size of the human or maize genome, and 1000x greater than the genome size of E. coli. Thus, the association of a greater-than-17- ...
Whole genome analyses using PopGenome and VCF files
Whole genome analyses using PopGenome and VCF files

... would like to performe whole genome analyses via the readData function the user could split a whole genome VCF file into SNP chunks and analyse those chunks seperately or concatenate them afterwards via the function concatenate.regions. If GFF files for each VCF file are available they need to be st ...
Bioinformatics Dr. Víctor Treviño  Pabellón Tec
Bioinformatics Dr. Víctor Treviño Pabellón Tec

... SEQUENCE SIMILARITY - TERMS Homologous: similar due to common ancestry  Analogous: similar due to convergent evolution  Orthologous: homologous with conserved function (by speciation in separated species)  Paralogous: homologous with different function (commonly within the same species) ...
PDF - Oxford Academic
PDF - Oxford Academic

... determined. Thus, cap addition sites and ATA boxes can only be inferred by homology with the 5' non-coding regions of other eukaryotic genes. Unfortunately, this comparison does not give an unambiguous answer. In both genes there are two potential cap addition sites. In the Lba gene these sites corr ...
Identification of genes from flat oyster Ostrea
Identification of genes from flat oyster Ostrea

... Ostrea edulis [1, 2]. Despite 30 years of research on this protozoan pathogen, host parasite interactions are poorly known and few sequence data is available for O. edulis in public databases. A recent study has been conducted to investigate the transcriptome during an in vitro infection of O. eduli ...
DNA sequence of the rat growth hormone gene: location of the 5
DNA sequence of the rat growth hormone gene: location of the 5

... All d i g e s t i o n s v/ere done with enzymes purchased fran e i t h e r Mew England Biolabs, rtethesda Pesearch Laboratories, o r Poehringer f'annheim. Digestions were usually done with a s u b s t a n t i a l excess of enzyme and approximately in accordance with t h e conditions provided by t h ...
No Slide Title
No Slide Title

... • Polymerases II & III (+ IV & V in plants) all help • many are from transposons or gene fragments made by transposons (pack-MULES) • ~ 10-25% is anti-sense: same region is transcribed off both strands ...
Differential expression of sex-linked and autosomal germ
Differential expression of sex-linked and autosomal germ

... not in any of a variety of somatic tissues (10). The pattern of expression of these 36 genes throughout spermatogenesis in the mouse is shown in Figure 1. As expected, on the basis of the manner in which these genes were identified, all were expressed in premeiotic spermatogonia, including primitive ...
Using comparative genomic hybridization to
Using comparative genomic hybridization to

... duplications and deletions associated with population divergence and speciation [Anopheles gambiae: [18,19]], and genomic regions that differentiate humans from other primate species [20,21]. While most studies rely only on presence or absence metrics, a few studies have suggested that the relations ...
The UCSC Known Genes
The UCSC Known Genes

... Select best mRNA for each protein. A set of candidate mRNA alignments are selected from the filtered mRNAs that aligned to the genome and have corresponding protein sequences in the Swiss-Prot/TrEMBL data as determined via the cross-reference table spXref2. For hg17, this list contains 74 290 entrie ...
The mitochondrial genome of the soybean cyst nematode
The mitochondrial genome of the soybean cyst nematode

... amplicons (Riepsamen et al. 2008), most multigenic fragments were then cloned directly into the pGEM-T Easy vector system (Promega, Madison, Wisconsin) and sequenced by primer walking. As this poly(T) variation has been found to be primarily an artefact of amplification of templates with extensive p ...
< 1 ... 23 24 25 26 27 28 29 30 31 ... 198 >

Transposable element



A transposable element (TE or transposon) is a DNA sequence that can change its position within the genome, sometimes creating or reversing mutations and altering the cell's genome size. Transposition often results in duplication of the TE. Barbara McClintock's discovery of these jumping genes earned her a Nobel prize in 1983.TEs make up a large fraction of the C-value of eukaryotic cells. There are at least two classes of TEs: class I TEs generally function via reverse transcription, while class II TEs encode the protein transposase, which they require for insertion and excision, and some of these TEs also encode other proteins. It has been shown that TEs are important in genome function and evolution. In Oxytricha, which has a unique genetic system, they play a critical role in development. They are also very useful to researchers as a means to alter DNA inside a living organism.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report